ID: 1152888962

View in Genome Browser
Species Human (GRCh38)
Location 17:82869100-82869122
Sequence GGAGGCTTGGGTGCTCCCCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 294
Summary {0: 1, 1: 0, 2: 2, 3: 12, 4: 279}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152888950_1152888962 20 Left 1152888950 17:82869057-82869079 CCACCTGGGGAGGAGTGCTTATC 0: 1
1: 0
2: 0
3: 14
4: 141
Right 1152888962 17:82869100-82869122 GGAGGCTTGGGTGCTCCCCCTGG 0: 1
1: 0
2: 2
3: 12
4: 279
1152888951_1152888962 17 Left 1152888951 17:82869060-82869082 CCTGGGGAGGAGTGCTTATCTGG 0: 1
1: 0
2: 1
3: 8
4: 134
Right 1152888962 17:82869100-82869122 GGAGGCTTGGGTGCTCCCCCTGG 0: 1
1: 0
2: 2
3: 12
4: 279

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152888962 Original CRISPR GGAGGCTTGGGTGCTCCCCC TGG Intronic
900154078 1:1197182-1197204 GGGGGCTTGGAGGCTCACCCAGG - Exonic
900229840 1:1551047-1551069 GCAGGCCTGGCTGCTTCCCCAGG + Intronic
900440363 1:2652065-2652087 GGGGGTGTGGGTGCTCCTCCAGG - Intronic
900440501 1:2652707-2652729 GGGGGTGTGGGTGCTCCTCCAGG - Intronic
900441602 1:2658365-2658387 GGGGGCGTGGGTGCTGCTCCAGG - Intronic
900444389 1:2672775-2672797 GGGGGCGTGGGTGCTGCTCCAGG - Intronic
900445291 1:2677431-2677453 GGGGGCGTGGGTGCTGCTCCAGG - Intronic
900446277 1:2682610-2682632 GGGGGCGTGGGTGCTGCTCCAGG - Intronic
900447818 1:2690281-2690303 GGAGGTGTGGGTGCTGCTCCAGG - Intronic
900450670 1:2748061-2748083 GGAGGTGTGGGTGCTGCTCCAGG - Intronic
900451167 1:2750546-2750568 GGGGGTGTGGGTGCTGCCCCAGG - Intronic
900453565 1:2762672-2762694 GGGGGTGTGGGTGCTGCCCCAGG - Intronic
900453939 1:2764603-2764625 GGGGGTGTGGGTGCTGCCCCAGG - Intronic
900454278 1:2766257-2766279 GGGGGTGTGGGTGCTGCCCCAGG - Intronic
900455007 1:2769933-2769955 GGGGGTGTGGGTGCTGCCCCAGG - Intronic
900455386 1:2771865-2771887 GGGGGTGTGGGTGCTGCCCCAGG - Intronic
900455757 1:2773679-2773701 GGGGGTGTGGGTGCTGCCCCAGG - Intronic
900486292 1:2924319-2924341 GGAGGCTCAGGTTCTCCCCTGGG + Intergenic
900627540 1:3615825-3615847 GGTGGCCTGGGTGCCCCACCAGG - Intergenic
900643015 1:3696290-3696312 GGAGGCTCTGCTGCTCCCCAAGG + Intronic
900766903 1:4511961-4511983 GGAGGATTGGAGGCTCGCCCCGG - Intergenic
900918089 1:5652352-5652374 GGAGGCTTGGGCGCTCCAGGAGG - Intergenic
900959681 1:5910891-5910913 TGAGGGTTGGGGGCTCCCTCTGG - Intronic
903043792 1:20551679-20551701 GGAGGGTTGGGGGCAGCCCCTGG + Intergenic
903543025 1:24107557-24107579 GGAGGCTTGGGTGGTGGTCCTGG - Intronic
903762389 1:25707914-25707936 GGAGGCTGGGATGGACCCCCAGG + Intronic
904489262 1:30848100-30848122 GGAGGCTTGGGGTCTCCTGCAGG + Intergenic
905359476 1:37409282-37409304 GGAGCCTTGGGGGCTTCCTCTGG - Intergenic
905469255 1:38179513-38179535 GGAGCATTGGCTGCTCCCCGTGG + Intergenic
905824926 1:41020294-41020316 TGAGGATTAGGTGCTCCTCCAGG + Exonic
912412837 1:109490016-109490038 GGAGGCCTGGGTCCCACCCCGGG - Exonic
914716724 1:150260091-150260113 GGAGGCCAGGGTTCTGCCCCAGG + Intronic
915029296 1:152862431-152862453 GGAGAGCTGGGTGCTCTCCCAGG - Intergenic
915310721 1:155004674-155004696 GAAGGGTAGGGGGCTCCCCCTGG + Intronic
915638802 1:157205160-157205182 GGAGGATTGGTTCCTTCCCCAGG - Intergenic
917730134 1:177866890-177866912 GAAGGCCTGTGTGCTCACCCTGG - Intergenic
917838677 1:178960214-178960236 GGCTTCTTGGGTGCTCCCCATGG - Intergenic
919857092 1:201713403-201713425 GGAGGCTTGAGTGCTCAACAGGG + Intronic
920495769 1:206454024-206454046 GCAGGCTTGGGTGGGCCCACGGG - Intronic
922561512 1:226572945-226572967 GGAGGCCTGGGTTCTAGCCCTGG - Intronic
922718965 1:227890683-227890705 GGAGGCCTGGAGCCTCCCCCTGG - Intergenic
924763410 1:247009255-247009277 GTAACCTTGGGTGCTCCCCTAGG - Intergenic
1063504079 10:6580368-6580390 GGAGGCTGGCGAGCGCCCCCTGG - Intergenic
1069934530 10:71906114-71906136 GGAGGCTGGGGTTCCTCCCCTGG - Intergenic
1070966120 10:80532033-80532055 GGAGGCTTCAGTTCTCCACCTGG + Exonic
1072257131 10:93631144-93631166 GGAGGCCTGGGGCCTCCCCGGGG + Intronic
1073467864 10:103704735-103704757 GGCGGCCTGGGGGCTTCCCCAGG + Intronic
1074516452 10:114174413-114174435 GGAGGCGTGGGTGCCCAGCCAGG - Intergenic
1075405490 10:122192886-122192908 CGAGCCCTGGGTGCTGCCCCGGG - Intronic
1075485782 10:122820975-122820997 GGAGGCTGGGCTACTCCTCCTGG + Intergenic
1075620734 10:123926339-123926361 TGTGGCTTGGATGCTCCTCCTGG + Intronic
1076010188 10:126981384-126981406 GGAAGCTAGGGTGTACCCCCAGG + Intronic
1076888503 10:133273236-133273258 GGAGACAAGGGTGCTCACCCCGG + Exonic
1076992862 11:284701-284723 GGGTGCCTGGGGGCTCCCCCTGG + Intronic
1077069486 11:661772-661794 GGAGGCATGGGTGCTCTGTCAGG + Intronic
1078929812 11:15904392-15904414 GAAGGTTTAGGTGCTCTCCCTGG + Intergenic
1081716270 11:45252579-45252601 GGAGGGCCTGGTGCTCCCCCTGG - Exonic
1083490937 11:63014766-63014788 AGGGCCTTGGGTGCTCCCCATGG - Exonic
1083614547 11:64019742-64019764 GCAGGCTTGAGAGCTGCCCCGGG + Intronic
1083811903 11:65111048-65111070 GTAGTCTTGGGTCCTCCCCAGGG + Intronic
1084215388 11:67644649-67644671 GGAGGCTTGGCTGCACCCCCTGG + Intronic
1084778722 11:71395234-71395256 GGAGGCTATGGGGCTCCCACAGG + Intergenic
1084947327 11:72645403-72645425 GGAGCCTTGGTTGCCCCCTCAGG - Intronic
1085043337 11:73339685-73339707 GGAGGGTTAGGTGCTCCCCAGGG + Intronic
1085509473 11:77080926-77080948 GGGGGCTGGGGTGCTCACCAGGG - Intronic
1089126117 11:116177755-116177777 GGAGGCCTGGGTGCCCCAGCTGG - Intergenic
1090057399 11:123435116-123435138 GGAGGCTCAGGTGCTGCTCCAGG - Intronic
1090799462 11:130161249-130161271 GAAGGCTTGGGCCCTTCCCCTGG + Intronic
1090799605 11:130162048-130162070 GGAGGTGTGGCTGCTGCCCCTGG + Intronic
1090837216 11:130462295-130462317 GGGGGCTTTGCTGCTGCCCCTGG + Intronic
1096806273 12:54143055-54143077 GGAGGATGGGGAGCTCCCCGTGG + Intergenic
1103446673 12:120999461-120999483 GGAGGCTGCTCTGCTCCCCCAGG + Exonic
1104713893 12:131004388-131004410 GGGAGCTGCGGTGCTCCCCCGGG + Intronic
1104815785 12:131644680-131644702 GGAGGCCTTGGTCCTCCCCAAGG - Intergenic
1105067942 12:133216623-133216645 GGAGGCTCAGGTGCAGCCCCAGG - Intergenic
1106297404 13:28428579-28428601 AGAGGCTTGGGTGCTTGACCTGG + Intronic
1122347910 14:101071828-101071850 GCAGGCTGGCGGGCTCCCCCAGG - Intergenic
1124247146 15:28080580-28080602 GCAAGCTGGGGAGCTCCCCCTGG + Intronic
1126145985 15:45473287-45473309 GGAGGCTGGGTGGCTGCCCCAGG - Intergenic
1128257998 15:66212424-66212446 GGAAGCTAGGGTGCCCTCCCTGG + Intronic
1128711820 15:69877907-69877929 GGACTCTTGGGTCCTCCCTCGGG - Intergenic
1131199703 15:90386619-90386641 GGAGCCTGGGGTGTTCCCACTGG + Intergenic
1131554001 15:93380893-93380915 GGTGGCCTGGGGGCTCCCCTTGG + Intergenic
1132485615 16:189246-189268 GGAGGCTTGAGAGCTCCAACGGG - Exonic
1132995680 16:2821230-2821252 GGAGGCTTGGCTGCTGCCAGGGG + Intronic
1134165775 16:11928133-11928155 GCAGGCTGGGGTCCTGCCCCAGG + Intronic
1134494947 16:14725607-14725629 GCAGGCTGGGGTCCTGCCCCAGG - Intronic
1134500330 16:14764727-14764749 GCAGGCTGGGGTCCTGCCCCAGG - Intronic
1134526872 16:14951339-14951361 GCAGGCTGGGGTCCTGCCCCAGG - Intronic
1134545533 16:15105009-15105031 GCAGGCTGGGGTCCTGCCCCAGG + Intronic
1134580249 16:15364323-15364345 GCAGGCTGGGGTCCTGCCCCAGG + Intronic
1134660867 16:15983459-15983481 GGAGGCTGGGGTTTTCACCCAGG + Intronic
1134714449 16:16349816-16349838 GCAGGCTGGGGTCCTGCCCCAGG - Intergenic
1134722324 16:16393180-16393202 GCAGGCTGGGGTCCTGCCCCAGG - Intronic
1134945103 16:18318689-18318711 GCAGGCTGGGGTCCTGCCCCAGG + Intronic
1134952367 16:18358842-18358864 GCAGGCTGGGGTCCTGCCCCAGG + Intergenic
1135311168 16:21405547-21405569 GCAGGCTGGGGTCCTGCCCCAGG + Intronic
1135364120 16:21837998-21838020 GCAGGCTGGGGTCCTGCCCCAGG + Intronic
1135447722 16:22533350-22533372 GCAGGCTGGGGTCCTGCCCCAGG - Intronic
1136150322 16:28343442-28343464 GCAGGCTGGGGTCCTGCCCCAGG + Intronic
1136166559 16:28457280-28457302 GCAGGCTGGGGTCCTGCCCCAGG + Intronic
1136196416 16:28657752-28657774 GCAGGCTGGGGTCCTGCCCCAGG - Intronic
1136212756 16:28771877-28771899 GCAGGCTGGGGTCCTGCCCCAGG - Intronic
1136257478 16:29051796-29051818 GCAGGCTGGGGTCCTGCCCCAGG - Intronic
1136307872 16:29384543-29384565 GCAGGCTGGGGTCCTGCCCCAGG + Intronic
1136321288 16:29486087-29486109 GCAGGCTGGGGTCCTGCCCCAGG + Intronic
1136435968 16:30226057-30226079 GCAGGCTGGGGTCCTGCCCCAGG + Intronic
1137550449 16:49433975-49433997 CCAGGCTTGGGTGCAGCCCCAGG + Intergenic
1137892218 16:52174630-52174652 AGAGCCTTGGGTGCACACCCAGG - Intergenic
1139855561 16:69976986-69977008 GCAGGCTGGGGTCCTGCCCCAGG + Intergenic
1140367172 16:74391115-74391137 GCAGGCTGGGGTCCTGCCCCAGG - Intronic
1141613569 16:85197651-85197673 GGAAGCTTGGCAGCTCCCTCCGG + Intergenic
1142224654 16:88871647-88871669 GGAGTGATGGGTGCTCCCCAGGG - Intergenic
1142374611 16:89700703-89700725 GCAGGCTTGGGTGCTGCCTACGG - Intronic
1143148168 17:4789828-4789850 GGAGGCTCGGGTGCACGGCCCGG + Exonic
1143731047 17:8882965-8882987 TGAGGCTTGGAAGCTCCCTCTGG - Intronic
1143780843 17:9228500-9228522 GGTGGCCTGGGTGCTGCCGCTGG + Intronic
1143781371 17:9231293-9231315 GGAGGCTGGGGTCCCCCCCCGGG - Intronic
1144751801 17:17653851-17653873 GGAGGTTTGGCAGCTCCGCCTGG - Intergenic
1145275089 17:21424373-21424395 GGAGGATGGGGTGCTCCCTACGG + Intergenic
1145312943 17:21710273-21710295 GGAGGATGGGGTGCTCCCTACGG + Intergenic
1147448578 17:40489917-40489939 TGAGGCCTGGGTTCACCCCCTGG - Intronic
1147890337 17:43712470-43712492 GGAAGCTGGGGTGTGCCCCCAGG - Intergenic
1148238384 17:45983959-45983981 GGAGGCCTGGGAGGTCCCCAGGG - Intronic
1148666639 17:49379773-49379795 GCATGCTTGGGTGCTCTCCGAGG - Intronic
1148856203 17:50580432-50580454 GGACTGCTGGGTGCTCCCCCCGG - Intronic
1149543762 17:57488087-57488109 GGTGGCTTGGCTGCTGCCCTGGG - Intronic
1150211978 17:63446567-63446589 GGAGGGCCGGGAGCTCCCCCGGG + Intergenic
1150272311 17:63874285-63874307 GGAGGCGGTGGGGCTCCCCCAGG + Intronic
1150275858 17:63897182-63897204 GGAGGCGGTGGGGCTCCCCCAGG + Intergenic
1151360495 17:73585694-73585716 GTGGGGTTGGGGGCTCCCCCTGG - Intronic
1151570024 17:74921460-74921482 GGAGTCTTGGGAGCTTGCCCTGG - Intronic
1151682873 17:75630931-75630953 GGAGGCTTGTGGGCTCTTCCCGG - Intronic
1151743582 17:76000326-76000348 GGAGGCGTCTGTGCTCTCCCGGG - Exonic
1152565005 17:81096453-81096475 GGATGCTGGGGTGCGCCTCCAGG - Intronic
1152751466 17:82064390-82064412 GGTGGCTTGGGGACTCCTCCCGG - Intronic
1152888962 17:82869100-82869122 GGAGGCTTGGGTGCTCCCCCTGG + Intronic
1154117034 18:11620174-11620196 GCAGGCTGGGGTCCTGCCCCAGG + Intergenic
1154210737 18:12376974-12376996 GGAGGCAGGGCTGCTCGCCCGGG + Exonic
1154355003 18:13618281-13618303 GGAGGCCTGGGCTTTCCCCCGGG + Intronic
1156337979 18:36186955-36186977 GGAAGCTCGGGGGCTTCCCCCGG - Intergenic
1156447731 18:37249592-37249614 GGAGTCTTGGGGGCTCCTCAGGG - Intronic
1157287140 18:46384611-46384633 GGAGGCTTTGCTGCTTCTCCAGG - Intronic
1160011523 18:75110075-75110097 GGAGGCTGGGGAGCGCCCCTGGG + Intergenic
1160395007 18:78564384-78564406 GAAGGGCTGGGTTCTCCCCCTGG - Intergenic
1161031394 19:2059441-2059463 CTAGGCTTGGGGCCTCCCCCAGG - Intergenic
1161400509 19:4064986-4065008 GGAGGAGCGGGTGCCCCCCCAGG - Intronic
1161615337 19:5267083-5267105 GGAGGATTGAGTGCTCAACCAGG - Intronic
1161975398 19:7605626-7605648 TCAGGCTTGGCTCCTCCCCCAGG + Intronic
1162375837 19:10304934-10304956 TGAGGCCTGGGTCTTCCCCCGGG + Exonic
1162960068 19:14120408-14120430 GGAGGCCTGGTTGCCCCTCCCGG + Exonic
1163092989 19:15034252-15034274 GGAGTCTTGGTTGGTCACCCAGG - Intergenic
1163156219 19:15441050-15441072 AGAGGCTTGGGTCCTCCCTGGGG - Intronic
1163242067 19:16070406-16070428 GGAGACCTGGATGCTCCCCAGGG - Intronic
1163692202 19:18744026-18744048 GGATGCGTGGGACCTCCCCCCGG - Intronic
1165294548 19:34916210-34916232 GCAGTCATGGCTGCTCCCCCTGG + Intergenic
1165775628 19:38403013-38403035 AGGGGCTTGGGTGCTCCCATTGG - Intergenic
1165796853 19:38524606-38524628 GGAGCCTTGGGTGCAGACCCGGG - Intronic
1166960846 19:46495074-46495096 GGAGGGGTGGGTGCCTCCCCGGG + Exonic
1167050386 19:47074495-47074517 GGAGGCCTGGCTGCTCTCCTTGG + Intronic
1167679336 19:50909666-50909688 GGAGCCCTGGGTCCGCCCCCTGG - Intronic
1168102665 19:54149307-54149329 GGATTCTCGGGTGCTCCACCAGG - Intronic
1168489028 19:56792287-56792309 GGAGGCTGAGGTGATCCACCCGG + Intronic
926759150 2:16262004-16262026 GCAGGCTTGGATGCTCTTCCAGG - Intergenic
927197844 2:20560300-20560322 CCAGGCCTGGGTGCTGCCCCAGG - Intergenic
927458649 2:23278708-23278730 GGATGGATGGGTGCTCCTCCAGG + Intergenic
927710483 2:25322694-25322716 GGAGGCTTGGGTGGTCATCTCGG - Intronic
928082615 2:28324333-28324355 GGAGCCTTGGGTTCTGTCCCTGG - Intronic
930156736 2:48113704-48113726 GGAGGGGTGGCTGCTCCTCCCGG - Intergenic
931172086 2:59814294-59814316 GGGGGCTGGGGTGCTCACTCTGG - Intergenic
933840712 2:86283909-86283931 GGAGGGTGGGCTGCTCCCCAAGG - Intronic
935269715 2:101423388-101423410 GGAGGCATGAGGGCTCCTCCTGG + Intronic
937952699 2:127400979-127401001 GGAGGCAGGGGCGCTCCGCCGGG - Intergenic
942218018 2:173741590-173741612 TGAGGCTAGGGTGCTCCTTCTGG - Intergenic
945234940 2:207625204-207625226 CGAGCCCTGGGTGCTCCGCCGGG - Exonic
946225634 2:218262769-218262791 GGGGGCTTTGGGGCTCTCCCTGG + Exonic
946231766 2:218295753-218295775 GGAGGCTCTGGTGGTGCCCCTGG + Intronic
1169205694 20:3739420-3739442 GCAGGCTTGGGTTCTCCGCAGGG + Intronic
1169333074 20:4731611-4731633 GGAGGCCTGGGTCCTGCCCTTGG - Exonic
1169389581 20:5178771-5178793 GAAGGCAAGGGTGCTCCCCACGG + Intronic
1170591910 20:17777702-17777724 GGAGGCTTGGATCCTCCAGCTGG - Intergenic
1170907490 20:20528921-20528943 GGAGGCTTTGGGGCTCTGCCAGG - Intronic
1170957192 20:20991937-20991959 GGAGGGCTTGGTGCTCCCTCAGG + Intergenic
1171332446 20:24352436-24352458 GAAGGACTGGGTGCTCCCTCTGG - Intergenic
1171439422 20:25148474-25148496 GGAGGCGGGAGTGCTCTCCCAGG - Intergenic
1173611440 20:44371077-44371099 GGAGGCCTGGGTGCTCCCCTGGG + Intronic
1176069411 20:63218281-63218303 GGAGGCTAGGATCCTCCCCGAGG - Intergenic
1176122096 20:63458553-63458575 GGAGACTTGGGGGCTGCCCGGGG - Intronic
1178357596 21:31921572-31921594 AGATGCTTGGGTGCTCCCATAGG + Intronic
1179320829 21:40289732-40289754 GTAGGGTTTGGTGCTCCCCAAGG + Intronic
1179565126 21:42242864-42242886 GGTGGCTGGGCTGCACCCCCGGG + Intronic
1180032417 21:45221589-45221611 GCTGGCCTGGGTGCTGCCCCTGG - Intronic
1180155841 21:45977148-45977170 GGAGGCTCGGGTCCACCCGCAGG + Intergenic
1180848151 22:18995533-18995555 GGAGACTGGGGTGCTGCTCCTGG + Intergenic
1180868827 22:19134699-19134721 GGGGGCTGGGGTGCACCCCCAGG + Intronic
1181027458 22:20134180-20134202 GGTGGCCTGGGTGCTCACCTGGG + Intronic
1181516110 22:23414759-23414781 GGAGGCCGGGGTGCCCCTCCAGG - Intergenic
1181770346 22:25120511-25120533 GAGGGCTTGGGTGCTCCACAGGG + Intronic
1182431677 22:30302536-30302558 GGAGGCTTGAGTTCTCCCTCTGG - Intronic
1182547117 22:31082813-31082835 GGAGACTGGAGTGCACCCCCTGG + Intronic
1183306937 22:37087640-37087662 GGAGACTTGGGTGCTGCAGCAGG - Intronic
1183564585 22:38604412-38604434 AGAGGTTTGGGAGCTTCCCCAGG - Intronic
1183591865 22:38783659-38783681 GGAGGCTTGGGTGCTGCTGCTGG + Intronic
1184158191 22:42682718-42682740 TGAGGCCTGGGTGCTGCCTCAGG + Intergenic
1184271268 22:43385651-43385673 GGAGGCTTGTGTCCCCACCCAGG - Intergenic
1185275258 22:49947893-49947915 GCAGGCATGGGGGCTGCCCCAGG - Intergenic
950203403 3:11060648-11060670 GGAGGCTCGAGTGCTCCCCAAGG + Intergenic
954318125 3:49812363-49812385 GGAGGCTTGGGCCCTGCACCTGG + Intronic
956788135 3:72659863-72659885 GGAGGCTTGGGAACTCCTCCTGG + Intergenic
959689881 3:109187455-109187477 GGAGGCTGGGCTGCTTCCACAGG - Intergenic
961554773 3:127690381-127690403 GAGGGCTTGGCTCCTCCCCCAGG + Exonic
962152140 3:132904215-132904237 GGATTCTTGGGTGATCCTCCTGG - Intergenic
962200864 3:133400187-133400209 GGAGGCTGGGGGGCTCTCCAGGG - Exonic
965643246 3:170853899-170853921 GGAGGCACAGGTGCTTCCCCTGG - Intronic
968273833 3:197424848-197424870 GGAGGTCTGCGTGCTCTCCCAGG - Intergenic
968481155 4:833631-833653 GCAGGCTTGGTTCCTCCGCCAGG - Intergenic
976028382 4:80720056-80720078 GGAGACTTCAGTGCTCTCCCTGG - Intronic
978362134 4:107942219-107942241 GAGGGCTTGGGTTCACCCCCAGG - Intronic
978400509 4:108325609-108325631 GGAGGTTTGGGTGGTGCACCTGG + Intergenic
984872280 4:184336442-184336464 GGAGGCCTTGGGGCTCCACCAGG - Intergenic
985671370 5:1208686-1208708 GGAGGCCTTCCTGCTCCCCCGGG + Intronic
986232963 5:5883799-5883821 GGAGACCAGGGAGCTCCCCCTGG - Intergenic
997384303 5:133460308-133460330 GGTGGCTTGGTTGCTGCCCTTGG - Intronic
999393073 5:151208479-151208501 GGAGTCATGGGGCCTCCCCCAGG + Intronic
1001084144 5:168688138-168688160 AGAGGCTTAGGTGCACCCACAGG + Intronic
1002299386 5:178248756-178248778 GGAGGTTAGGTTGCTCGCCCAGG + Intronic
1003290514 6:4775781-4775803 GGTGGGGTGGGTGCTCCACCTGG + Intronic
1005463839 6:26092914-26092936 CCAGGCCTGGGTGCTCCACCTGG - Exonic
1006239118 6:32661991-32662013 GGAGGCTGGGGTGCTCCACGTGG + Exonic
1006245563 6:32731444-32731466 GGAGGCTGGGGTGCTCCAGATGG + Intergenic
1006247749 6:32755041-32755063 GGAGGCTGAGGTGCTCCACATGG + Intergenic
1006248258 6:32758874-32758896 GGAGGCTGGGGTGCTCCACTTGG + Exonic
1006472925 6:34238143-34238165 GCGGGCTTGGGTGCCCCCTCTGG + Intronic
1006834146 6:36986420-36986442 GCAGGCCGGGGCGCTCCCCCGGG + Intergenic
1007357668 6:41333044-41333066 GGAGGCCTGGGTGCTAGTCCTGG + Intergenic
1007383313 6:41504184-41504206 CGAGGCTGGGGGGCTCCCCCGGG + Intergenic
1008273822 6:49520470-49520492 GGAGCCTTGGCTCCTCCCTCAGG - Intronic
1019669885 7:2271797-2271819 GGAGGCTCGGGGACTCCCCGGGG + Intronic
1019776257 7:2913570-2913592 GAAGGCCTGGCTGCTGCCCCGGG + Intronic
1019808243 7:3144760-3144782 AGAGGCTTGGGGCCTCTCCCGGG + Intronic
1020130228 7:5555361-5555383 GGGGGCTGGGCTGCACCCCCGGG - Intronic
1020382031 7:7557369-7557391 GCAGGCTAGGGTGGTCCCTCAGG - Intergenic
1021206683 7:17788930-17788952 GGAGGCTTGACTGCTCTCCTTGG + Intergenic
1024123501 7:46268325-46268347 GGAGGCTTGGCAGCCCCTCCAGG + Intergenic
1025604403 7:63029071-63029093 GGAGGCCTCGGGGCTTCCCCAGG - Intergenic
1031948153 7:127862751-127862773 GGATGGATGGGTGCTCTCCCAGG + Intronic
1032719262 7:134537430-134537452 GGAAGCTTGGGTCCTTTCCCCGG - Intronic
1032724230 7:134576199-134576221 GGAAGCTTGGGTCCTTTCCCCGG - Intronic
1033686663 7:143646784-143646806 TGAGGCTGCGGTGCTCTCCCTGG - Intronic
1033689071 7:143720523-143720545 TGAGGCTGCGGTGCTCTCCCTGG + Exonic
1033697946 7:143810830-143810852 TGAGGCTGCGGTGCTCTCCCTGG + Intergenic
1034223396 7:149461974-149461996 GGAGGCTAGAGTTCTCACCCAGG + Intergenic
1035224950 7:157427898-157427920 GGAGGCCTGGGGGGACCCCCGGG + Intergenic
1035918819 8:3654764-3654786 GTAGGACTGGGTGCTCCCACTGG + Intronic
1036528296 8:9556058-9556080 AGAGGCTGGGGTGGTCCCCGGGG - Exonic
1036780566 8:11644091-11644113 GGAGGCCTCGGGGCTTCCCCAGG + Intergenic
1037860115 8:22399034-22399056 TGTGGCTTGGGAGCGCCCCCAGG - Intronic
1039971512 8:42324938-42324960 GGAGGCTTGGGTGCTTAACATGG + Intronic
1040107632 8:43549481-43549503 GGAGGCTGGGGTTGTCCTCCAGG - Intergenic
1040111317 8:43568297-43568319 GGAGGCCTGGGTCCCCCACCAGG - Intergenic
1046294893 8:112204662-112204684 GGATGCTTGGATGCTCCCTAAGG + Intergenic
1049175622 8:141190740-141190762 GGAGTCATGGCTGCTCCTCCTGG + Intronic
1049444266 8:142622813-142622835 GGCGGCTTGGGTGGTCACGCTGG + Intergenic
1049446383 8:142633389-142633411 GTAGCCCTGGGTGCTCTCCCAGG + Intergenic
1049862647 8:144910478-144910500 GAAAGCCTGGGTGCTCCCTCTGG - Intergenic
1052203775 9:25813417-25813439 GGAGGCTTTGGTTCTCCCTGGGG + Intergenic
1053020030 9:34688331-34688353 GGAGGCTAGCCTGCTTCCCCAGG + Intergenic
1053431770 9:38046656-38046678 AGAGGCTTGCGTCCTGCCCCTGG - Intronic
1056750574 9:89347915-89347937 GGAGGGTTGGGTGAGCTCCCTGG + Intronic
1057170598 9:92960924-92960946 TGGTGATTGGGTGCTCCCCCTGG + Intronic
1057194749 9:93110762-93110784 GCAGGCTGGGGTGCCCTCCCCGG - Intronic
1057438666 9:95065449-95065471 GGGGGCCTGGGTGGGCCCCCTGG - Intronic
1059574163 9:115472594-115472616 GGAGGTTTGGGTTCTTGCCCTGG - Intergenic
1060018642 9:120109387-120109409 GGAGGGATGGGAGGTCCCCCTGG + Intergenic
1060069710 9:120535239-120535261 GGAGGCATGGGCTCTCCCTCTGG + Intronic
1060296796 9:122348471-122348493 GGAGCCTCTGGTGCTGCCCCGGG + Intergenic
1060301856 9:122378599-122378621 GCAGGCTTGCTTGCTCCCCCAGG - Intronic
1061312707 9:129774684-129774706 GGAGGGTTGGTGGGTCCCCCAGG + Intergenic
1061478158 9:130883009-130883031 AGACGCTTGGGTGCTCCTCTGGG - Intronic
1061801469 9:133115429-133115451 AGGGGCTTGGGAGGTCCCCCAGG - Intronic
1061887511 9:133599294-133599316 GGAAGCTTTGCTGCTCGCCCAGG + Intergenic
1062482928 9:136760728-136760750 GGAGCCTTGTCTTCTCCCCCAGG - Intronic
1062681758 9:137785821-137785843 GGACGCCTGGGTGCCCTCCCCGG + Intronic
1203792179 EBV:157590-157612 GGCGGCGGGGGTGCTCCCGCGGG + Intergenic
1186078705 X:5907669-5907691 GGAGGGTTTGGAGCTCCCACGGG + Intronic
1186298784 X:8176860-8176882 GGAGGTTTGTGTGCTCCCTCTGG + Intergenic
1197870452 X:131058467-131058489 GGGGGCTGGGGTGCTCGGCCGGG + Intronic
1199530496 X:148841791-148841813 AGAGGCTTCTGTGCTCTCCCTGG - Intronic
1200003646 X:153074202-153074224 GGAGGCTGAGGAGCTCCTCCAGG + Exonic
1200004077 X:153075807-153075829 GGAGGCTGAGGAGCTCCTCCAGG - Intergenic
1201062430 Y:10059288-10059310 GGAGGCTGGGGAGCACCCCAGGG + Intergenic
1201439527 Y:13993133-13993155 GGAGGTTTGTGTCCTCCCTCTGG + Intergenic
1201445046 Y:14049575-14049597 GGAGGTTTGTGTCCTCCCTCTGG - Intergenic
1201516695 Y:14825729-14825751 GGAGGGTTTGGAGCTCCCACGGG - Intronic