ID: 1152895200

View in Genome Browser
Species Human (GRCh38)
Location 17:82906964-82906986
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 408
Summary {0: 2, 1: 0, 2: 2, 3: 38, 4: 366}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152895200_1152895208 18 Left 1152895200 17:82906964-82906986 CCACAGGGCCTGTGTCATTCCCC 0: 2
1: 0
2: 2
3: 38
4: 366
Right 1152895208 17:82907005-82907027 ACACCTGTGAGGTGTCTATCAGG 0: 1
1: 0
2: 2
3: 8
4: 106
1152895200_1152895209 19 Left 1152895200 17:82906964-82906986 CCACAGGGCCTGTGTCATTCCCC 0: 2
1: 0
2: 2
3: 38
4: 366
Right 1152895209 17:82907006-82907028 CACCTGTGAGGTGTCTATCAGGG 0: 1
1: 0
2: 1
3: 9
4: 103
1152895200_1152895206 7 Left 1152895200 17:82906964-82906986 CCACAGGGCCTGTGTCATTCCCC 0: 2
1: 0
2: 2
3: 38
4: 366
Right 1152895206 17:82906994-82907016 GAGATGTGACCACACCTGTGAGG 0: 2
1: 0
2: 0
3: 17
4: 160

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152895200 Original CRISPR GGGGAATGACACAGGCCCTG TGG (reversed) Intronic
900334413 1:2154429-2154451 GAGGAATGACACAGTCTCAGAGG + Intronic
900549052 1:3244715-3244737 AGAGAAACACACAGGCCCTGGGG + Intronic
900589709 1:3454271-3454293 GGGGAAGGAGACCAGCCCTGCGG - Intergenic
900592387 1:3465804-3465826 GGGGCAGGACACAGGCCCCTGGG - Intronic
900624807 1:3603283-3603305 GAGAAAGGACTCAGGCCCTGCGG + Intronic
901237476 1:7675172-7675194 GGGGAAGTGCAAAGGCCCTGGGG + Intronic
902332267 1:15736428-15736450 GGGGCACGGCACAGGCCCTGTGG - Exonic
902555397 1:17243917-17243939 CCAGAATGAGACAGGCCCTGGGG - Intronic
902556991 1:17252765-17252787 GGCCAATGACAGAGGCCCTGAGG - Intronic
903541533 1:24099077-24099099 GATGAGTGACACAGGCCTTGGGG + Intronic
903661423 1:24981148-24981170 TGGGAAGGGCCCAGGCCCTGAGG + Intergenic
904402848 1:30268046-30268068 CGGGATTGGCACAGGTCCTGGGG + Intergenic
904712660 1:32442481-32442503 GGGGAATGACACAGCGGCAGGGG - Intergenic
905434695 1:37948493-37948515 GGGGATTGACTCAGACCCTTAGG + Intergenic
905884247 1:41483190-41483212 GGGGAATGGCAGGGGCCCTGTGG + Intronic
906357627 1:45120775-45120797 GGAGAATGAAATAGCCCCTGTGG - Intronic
906710279 1:47924290-47924312 GAGGAATGAAACAGGCTCTCAGG + Intronic
907660436 1:56387506-56387528 TGGGAAGGAGACAGGCCCAGGGG - Intergenic
909014342 1:70367041-70367063 GGGGAATGACACAGCAACAGGGG - Intronic
909139530 1:71846093-71846115 AGAGAATAACAGAGGCCCTGGGG - Intronic
915316849 1:155033541-155033563 GTGGAAGGCCACAGCCCCTGGGG - Exonic
917469299 1:175313020-175313042 GTGGAAAGATACAGGCCCAGAGG + Intergenic
917567910 1:176231264-176231286 GGGCAATGGCACAGGCCATGAGG + Intergenic
919673648 1:200360536-200360558 GGGAAATGACACATGCTCTCAGG + Intergenic
920178912 1:204120576-204120598 GGGGAATGAGGCAGGCCATGGGG - Intronic
921754127 1:218833665-218833687 GGAAAATGAAACAGGCCCTTGGG - Intergenic
921958007 1:221003894-221003916 AGGGAATGACAAAAGTCCTGAGG - Intergenic
922756731 1:228101136-228101158 GTGGCATGACAGAGGCTCTGAGG - Exonic
923672443 1:236052334-236052356 GGGAAAGGACACAGGCACTCAGG + Intronic
923874661 1:238034579-238034601 TGGGAATGAGACTGGCCCTTGGG + Intergenic
1062975252 10:1678181-1678203 GGGCAATGCCACAGGACCTCAGG + Intronic
1063762141 10:9091732-9091754 ACTGAATGACACAGGTCCTGAGG - Intergenic
1064773762 10:18752761-18752783 GGGGAATGACACAGCAGCAGGGG + Intergenic
1065810564 10:29439027-29439049 GGGGAATGACACAGCAGCAGGGG - Intergenic
1065915322 10:30350210-30350232 TGGTTATGACACAGGCACTGAGG - Intronic
1066097101 10:32083096-32083118 TGGGAAAGCCACAGGCCTTGGGG + Intergenic
1067253101 10:44606494-44606516 GGGGATACACACAGACCCTGTGG + Intergenic
1067944568 10:50682001-50682023 AGTGAATGACAGAGGCCCGGTGG + Intergenic
1069344043 10:67446381-67446403 GGGGAATGACACATTCCTTTGGG - Intronic
1069760530 10:70807944-70807966 GGGGAATAATGCAGTCCCTGGGG - Intergenic
1070569142 10:77627856-77627878 GAGGAATCGCACAGGGCCTGAGG + Intronic
1070866072 10:79708872-79708894 AGTGAATGACAGAGGCCCGGTGG + Intronic
1070879865 10:79847003-79847025 AGTGAATGACAGAGGCCCGGTGG + Intronic
1071481368 10:86067577-86067599 GGGGAAGGTGACAGGCACTGCGG + Intronic
1071632975 10:87231093-87231115 AGTGAATGACAGAGGCCCGGTGG + Intronic
1071646424 10:87363311-87363333 AGTGAATGACAGAGGCCCGGTGG + Intronic
1072564956 10:96609769-96609791 GGGGAATGACACTTTTCCTGGGG + Exonic
1072755926 10:98020830-98020852 TGTGAGTGACACAGGCCCAGTGG + Intronic
1074039555 10:109774769-109774791 AGGGATAGACAAAGGCCCTGGGG + Intergenic
1074982563 10:118631461-118631483 AGGGAGTGAAACAGGCCCTTTGG + Intergenic
1075872244 10:125779447-125779469 GGGCAAGTGCACAGGCCCTGAGG + Intergenic
1076670780 10:132120090-132120112 TTGGAATGCCAGAGGCCCTGGGG - Intronic
1077285170 11:1762371-1762393 GGGGAAGGCCAGTGGCCCTGGGG - Intronic
1077354929 11:2111349-2111371 GGGGAATGCAAGAGGCCCTGAGG - Intergenic
1077384102 11:2260953-2260975 AGAGAAAGCCACAGGCCCTGAGG + Intergenic
1077529108 11:3086847-3086869 GGGCATTGGCACAGCCCCTGAGG - Intergenic
1077826092 11:5809330-5809352 GGGGAGTGACACAGCCCATGGGG - Intronic
1079398483 11:20086328-20086350 CAGGAAGGACACAGGCCTTGAGG - Intronic
1079416723 11:20244790-20244812 GGGGAATTACATATGCCCTTAGG + Intergenic
1079952184 11:26819340-26819362 TGGGAATGAGACCGGCCCTTTGG - Intergenic
1082068321 11:47918543-47918565 GGGCAATGTCACAGGCAGTGGGG + Intergenic
1082903875 11:58285264-58285286 TGGGAGTGACACAGGCCGTTTGG + Intergenic
1083144308 11:60747270-60747292 GGGAGATGACACAGGACCTGAGG - Intergenic
1083407993 11:62471986-62472008 GGGAGATGACCCAGACCCTGGGG - Intronic
1083674739 11:64319042-64319064 GGGGAAGGTCCAAGGCCCTGGGG - Intronic
1086959326 11:92966775-92966797 GGGGAATGATACAGCCACTTTGG - Intergenic
1088753377 11:112864909-112864931 GGGGAGTGACAGAGGCTCTGGGG + Intergenic
1089084347 11:115804126-115804148 GGGGAAAAACAAAAGCCCTGAGG - Intergenic
1089506959 11:118969860-118969882 GGGGAACCACACAGACACTGGGG + Intergenic
1090047524 11:123349198-123349220 GTGCAATGACACAGGCAATGTGG - Intergenic
1091343110 11:134835304-134835326 AGGGAAAGCCAGAGGCCCTGAGG - Intergenic
1093950494 12:25160596-25160618 GGGGAATGACACAGTAGCAGGGG + Intronic
1094125820 12:27021613-27021635 GGTGGAAGACACAGTCCCTGGGG - Intergenic
1094583826 12:31758672-31758694 GGGGAATGACACAGCAGCAGGGG + Intergenic
1096613656 12:52819220-52819242 GGGGAATGGCCCAGACCCAGGGG - Intergenic
1097032706 12:56101153-56101175 GGGGCATGTAACAGGCTCTGAGG + Exonic
1097176793 12:57147894-57147916 GGGGGATAACACTGGGCCTGAGG - Intronic
1097247812 12:57616210-57616232 GGAGAATGATACAGGCCCTAGGG + Intronic
1100195370 12:92239084-92239106 GAGGAAGGGCAAAGGCCCTGAGG - Intergenic
1100716865 12:97315197-97315219 GGGGAATGACACAGCAGCAGGGG - Intergenic
1100882445 12:99034029-99034051 AGGGAATGACACTGGGGCTGAGG + Intronic
1101825715 12:108218605-108218627 GGGGCATCACTCAGGGCCTGTGG - Intronic
1101855963 12:108443196-108443218 GGGGAATGACACAGCAGCAGGGG + Intergenic
1102420992 12:112802818-112802840 GGGAGAGGACAGAGGCCCTGGGG - Intronic
1102420999 12:112802838-112802860 GGGAGAGGACAGAGGCCCTGGGG - Intronic
1103247740 12:119472524-119472546 GGACAATGAGCCAGGCCCTGGGG - Intronic
1103586821 12:121962371-121962393 CAGGAAGGACACAGACCCTGGGG + Intronic
1103935625 12:124475019-124475041 AGGGGAGGACAGAGGCCCTGAGG - Intronic
1104167778 12:126250691-126250713 GTGGAAGTACAAAGGCCCTGAGG - Intergenic
1104627373 12:130369068-130369090 GGAGAATGACACACACACTGGGG - Intronic
1105013542 12:132771989-132772011 GTGGAATCACACAGGGCCAGTGG + Exonic
1105013794 12:132773777-132773799 GGGGACTCACACAGCCTCTGCGG - Intronic
1105013832 12:132773933-132773955 GGGGAAGGACTCAGCCTCTGAGG - Intronic
1105574656 13:21639108-21639130 TGTGAAAGTCACAGGCCCTGCGG + Intergenic
1105908223 13:24834992-24835014 TGGGAATGAGACTGGCCCTTTGG + Intronic
1106367006 13:29091093-29091115 GAGGAAGGATACAGACCCTGGGG - Intronic
1106556122 13:30810069-30810091 GGTGGATCACACAGGGCCTGGGG + Intergenic
1109909222 13:68888823-68888845 GGGGAATGACACAGCAGCAGGGG - Intergenic
1110137159 13:72082128-72082150 GAGGAATGACACAGATTCTGGGG - Intergenic
1110756390 13:79179663-79179685 GGGGAATGACACAGCAGCAGGGG - Intergenic
1112398664 13:99056843-99056865 GAGGAAAGACAGTGGCCCTGAGG + Intronic
1112749770 13:102570209-102570231 TGGAAAAGACACAGGACCTGTGG + Intergenic
1114143219 14:19941589-19941611 GGGAAATGGCAGAGACCCTGTGG + Intergenic
1116726190 14:48563790-48563812 GGGGAATGACACAGCACTAGGGG + Intergenic
1118984741 14:70744173-70744195 GGGGAACGTCACACACCCTGTGG + Intronic
1118992341 14:70808714-70808736 GGGGAATGACGGAGGCCTGGGGG - Intronic
1119692041 14:76680993-76681015 GGGGAATGACACAGCAGCAGGGG + Intergenic
1120794804 14:88620640-88620662 GGGAAATGCTACAGGCCCTGGGG + Exonic
1121267458 14:92613690-92613712 GTGGAAGGACAGAGGCACTGAGG + Intronic
1121615578 14:95311513-95311535 GGGAATTTACAAAGGCCCTGGGG - Intronic
1122987862 14:105220910-105220932 GGGGACATGCACAGGCCCTGGGG - Intronic
1202839749 14_GL000009v2_random:110928-110950 GGAGAATGACAAAAGCCCAGAGG + Intergenic
1202909125 14_GL000194v1_random:101068-101090 GGAGAATGACAAAAGCCCAGAGG + Intergenic
1202884142 14_KI270722v1_random:88149-88171 GGAGAATGACAAAAGCCCAGAGG - Intergenic
1123613746 15:22125021-22125043 TGGGAATTACACAGGAACTGAGG + Intergenic
1124800617 15:32829402-32829424 GGTGAATAACACAGGCCCCCAGG + Intronic
1125125073 15:36210636-36210658 GGGGCATCACAGAGGCCCGGAGG - Intergenic
1125170174 15:36757799-36757821 GGTGAATGACTCAGGCCTGGTGG - Intronic
1128343999 15:66842469-66842491 GGTGGATGACACAGGCCCGGCGG + Intergenic
1128387707 15:67162491-67162513 TGTGAAAGAGACAGGCCCTGTGG - Intronic
1128933799 15:71728404-71728426 AGGCAATGATCCAGGCCCTGGGG - Intronic
1129183805 15:73893649-73893671 GGGGGGTAACACAGACCCTGGGG - Intergenic
1129556533 15:76516078-76516100 GATGATTGACAAAGGCCCTGTGG - Intronic
1130027815 15:80285038-80285060 GGTGAACGGCACAGGCTCTGTGG + Intergenic
1130559517 15:84947142-84947164 AGGGAAGGACACAGGCCCTGAGG - Intergenic
1132203590 15:99971376-99971398 GGGGAAGGAGACAGCCCTTGGGG + Intergenic
1133061448 16:3177421-3177443 GGGGAATGACACAGCAGCAGGGG + Intergenic
1134127601 16:11627102-11627124 TGTGCATGACACAGCCCCTGGGG - Intronic
1134350980 16:13437549-13437571 GGGTAAACACACGGGCCCTGGGG - Intergenic
1135668384 16:24354547-24354569 GGACAATGACACATGCACTGGGG - Intronic
1136106229 16:28031921-28031943 GGGGAAAAACACATGCCCTGGGG + Intronic
1136553094 16:30992131-30992153 GGGACATGCCACAGCCCCTGGGG + Exonic
1137223513 16:46480081-46480103 GGGGAATGACAAAGGGTATGAGG - Intergenic
1137626613 16:49912808-49912830 GGGGAAAGGCTCAGGCCCTGAGG - Intergenic
1138384458 16:56626637-56626659 AGGGAATGACACGGGCAATGAGG - Intronic
1138385557 16:56633511-56633533 AGGGAATGACACGGGCAATGAGG - Intronic
1140207707 16:72947194-72947216 GGGGAATGCCGCAGGGCCCGAGG - Intronic
1141622393 16:85243361-85243383 GGGGAAGGACACGGGCAGTGGGG + Intergenic
1141801057 16:86309597-86309619 GGGGTGAGACACAGGCACTGCGG + Intergenic
1142598978 17:1043886-1043908 AGGGAATGACGCAGGGCCGGGGG + Intronic
1142629619 17:1216323-1216345 GGCAAATGACACAGCCCCTGTGG - Intronic
1143665692 17:8358099-8358121 GGGAAACGACACAAGGCCTGGGG + Intergenic
1143779167 17:9220469-9220491 GGGGGTTGACACAGGCCCAAGGG + Intronic
1143860007 17:9882388-9882410 GGGGAATGAGACAGCCACAGTGG + Intronic
1144244277 17:13347532-13347554 GGGGAATGACACAGCAGCAGGGG - Intergenic
1144854673 17:18261255-18261277 GGAGATTGAAACCGGCCCTGGGG + Intronic
1144887131 17:18470965-18470987 GTGGAAGGAAACAGGTCCTGAGG + Intergenic
1145145085 17:20473330-20473352 GTGGAAGGAAACAGGTCCTGAGG - Intergenic
1146653938 17:34624078-34624100 GGGGCATGACAAAGGCCCTCGGG - Intronic
1147335966 17:39727169-39727191 GGGGTATGACACAGTCACCGTGG - Intronic
1147980189 17:44269340-44269362 GGGGAGGGACACGGGTCCTGAGG + Intergenic
1148582638 17:48754205-48754227 GGGTGCTGAAACAGGCCCTGAGG - Intergenic
1151392372 17:73796105-73796127 TAGCAATGACACAGGTCCTGTGG + Intergenic
1151597829 17:75088671-75088693 TGGAAATGAGGCAGGCCCTGGGG - Intronic
1152269658 17:79316580-79316602 GAGGAAGGACACAGGCTGTGTGG - Intronic
1152460344 17:80439065-80439087 GAGGCAGGACACAGGCCCTGGGG - Intergenic
1152552525 17:81036704-81036726 TGGGAAAGGCACAGGCCCTGGGG + Intronic
1152705609 17:81841983-81842005 GGGCAACGGCAGAGGCCCTGAGG - Intergenic
1152872775 17:82766855-82766877 GGGGAATGACACAGGCCCTGTGG - Intronic
1152895200 17:82906964-82906986 GGGGAATGACACAGGCCCTGTGG - Intronic
1153826114 18:8876416-8876438 GGGGAATGACACAGCAGCAGGGG + Intergenic
1158031135 18:52966480-52966502 GGAGACTGACACAGGCTCTTGGG + Intronic
1158908443 18:62036627-62036649 GTGGAATGAAACCAGCCCTGTGG - Intergenic
1161004921 19:1930273-1930295 GCGGAATGACACAGCCCCTGGGG - Intergenic
1161486194 19:4537114-4537136 GAGGCATGGCCCAGGCCCTGGGG - Exonic
1161683604 19:5692581-5692603 GGGGGGTGACGCAGGGCCTGGGG - Intronic
1161971991 19:7587309-7587331 TGGCAAGGACAAAGGCCCTGGGG - Intergenic
1162151214 19:8646903-8646925 CAGGAAGAACACAGGCCCTGAGG + Intergenic
1163305171 19:16473240-16473262 GGGGATTGAGCCAGGCTCTGTGG + Intergenic
1163861669 19:19746212-19746234 GAGGCCTGCCACAGGCCCTGTGG - Intergenic
1164452722 19:28380833-28380855 GGGGACTGTCTCAGGCCCTTTGG + Intergenic
1165074954 19:33275544-33275566 GAGGAAAGACACTGTCCCTGGGG + Intergenic
1165885205 19:39073139-39073161 GGGAGATGACACAGGACCTGAGG + Intergenic
1167643605 19:50694793-50694815 GGGGAAGGGGAAAGGCCCTGGGG + Intronic
1167906610 19:52665751-52665773 GGGGAATGACACAGCAGCAGGGG + Intronic
1168371017 19:55834590-55834612 GTGGAATGACTGAGTCCCTGAGG - Intronic
1202633302 1_KI270706v1_random:19651-19673 GGAGAATGACAAAAGCCCAGAGG - Intergenic
1202659560 1_KI270708v1_random:55283-55305 GGAGAATGACAAAAGCCCAGAGG - Intergenic
925299870 2:2804105-2804127 GGGGAGTGACACTGGTGCTGAGG + Intergenic
926218379 2:10919448-10919470 GGGGACGGACACTGGCCCTCAGG - Intergenic
926314256 2:11697769-11697791 GGGGAAGGACACAAGGCCCGGGG - Intronic
927552555 2:24011936-24011958 TGGGAAGGGCAAAGGCCCTGAGG + Intronic
927575537 2:24199192-24199214 GGGGAATGACACAGCCGCAGGGG - Intronic
928322846 2:30296729-30296751 GGGGAAGGGCACAGGCTCTGGGG + Intronic
930539905 2:52692111-52692133 GGGTAATTACACAAGCCCTATGG + Intergenic
931899624 2:66772988-66773010 GCAAAATTACACAGGCCCTGGGG - Intergenic
931964588 2:67519211-67519233 GATTAATGACACAGGCACTGGGG - Intergenic
933938327 2:87225121-87225143 GGCCAAGGACACTGGCCCTGGGG - Intergenic
934044452 2:88160960-88160982 GGTGAATTACTCAGGGCCTGGGG - Intergenic
934119154 2:88823658-88823680 GGGGCAGGACCCAGACCCTGGGG - Intergenic
935047665 2:99496981-99497003 GGGGAATGACACAGCAACAGGGG + Intergenic
935600067 2:104913438-104913460 GGGCACTGACTAAGGCCCTGGGG + Intergenic
936095433 2:109527504-109527526 GAGGAATAACGCAGGCCCTGTGG + Intergenic
936282228 2:111152217-111152239 CGGGAAGGAGACAGGCCCAGGGG - Intronic
936354808 2:111740654-111740676 GGCCAAGGACACTGGCCCTGGGG + Intergenic
938092970 2:128445260-128445282 ACCGACTGACACAGGCCCTGTGG + Intergenic
938365408 2:130729502-130729524 TGAGAATGCCACAGGCCATGCGG - Exonic
941037020 2:160579931-160579953 GGAGAAGGACACAGCCTCTGAGG - Intergenic
941328276 2:164144011-164144033 GGGGAATGGCAAAATCCCTGAGG - Intergenic
941876043 2:170434472-170434494 GGGGAATGACACAGCAGCAGGGG - Intronic
944427064 2:199594638-199594660 TAGGAGTTACACAGGCCCTGAGG - Intergenic
944999511 2:205333170-205333192 GGGGAATGAGAAAAGCTCTGGGG + Intronic
945981854 2:216318619-216318641 GGGCAAGTTCACAGGCCCTGAGG + Intronic
947498025 2:230652976-230652998 GGGGAATGACACAGCAGCAGGGG + Intergenic
947556830 2:231100340-231100362 GGGGAATGACACAGCAGCAGGGG - Intronic
948466552 2:238154702-238154724 GGTGAATGACACGGCCCCGGAGG - Intergenic
948468974 2:238165424-238165446 GAGGAAGGACACAGGGCCAGAGG - Intronic
1168773466 20:430575-430597 AGGGAAGGACAAAGGCACTGGGG - Exonic
1168961896 20:1875811-1875833 GGGTTCTGACACAGGCTCTGCGG - Intergenic
1170863187 20:20128013-20128035 TGGGAATGAGACTGGCCCTTTGG - Intronic
1171970689 20:31563183-31563205 GGGGAGTAACACAGGCCTTGGGG - Intronic
1172174939 20:32966543-32966565 GGGGAAGGACACTGGGGCTGGGG + Intergenic
1172545496 20:35757951-35757973 GGGGCATTAGACAGGCACTGTGG - Intergenic
1173400719 20:42723587-42723609 GGGGTATTATGCAGGCCCTGAGG - Intronic
1173926860 20:46787278-46787300 GGGCAAGCACACAGGCCCGGAGG - Intergenic
1176099965 20:63360456-63360478 GGGGAATGCCTCAGATCCTGGGG - Intronic
1176111784 20:63414198-63414220 GGGGAAGGAGACAGGCCGTGAGG + Intronic
1176136387 20:63523907-63523929 GGGGAATGACACAGCCGTAGAGG - Intergenic
1176294766 21:5065583-5065605 GTGGGAGGACACAGGCCTTGAGG - Intergenic
1176628480 21:9115781-9115803 GGAGAATGACAAAAGCCCAGAGG + Intergenic
1176645515 21:9345512-9345534 GGAGAATGACAAAAGCCCAGAGG - Intergenic
1177834438 21:26172876-26172898 GGAGAGTCTCACAGGCCCTGCGG - Intergenic
1178067429 21:28921104-28921126 GGGTAATGACACAGGGGGTGGGG - Intergenic
1178279692 21:31270865-31270887 AGGGACAGGCACAGGCCCTGAGG - Intronic
1179036002 21:37759233-37759255 AGGGAAAGACAGAGGCCCTGTGG - Intronic
1179184290 21:39072545-39072567 GGGGAATGACACAGACACAAAGG + Intergenic
1179189280 21:39109005-39109027 GATGAATGACACAGGCCCCTGGG + Intergenic
1179862284 21:44196543-44196565 GTGGGAGGACACAGGCCTTGAGG + Intergenic
1179997372 21:44980250-44980272 TGGGATGGCCACAGGCCCTGGGG + Intergenic
1180172687 21:46067938-46067960 GGGGCATGGCTCAAGCCCTGTGG + Intergenic
1180327028 22:11438844-11438866 GGAGAATGACAAAAGCCCAGAGG - Intergenic
1180367410 22:11953644-11953666 GGAGAATGACAAAAGCCCAGAGG + Intergenic
1180378666 22:12117665-12117687 GGAGAATGACAAAAGCCCAGAGG - Intergenic
1180418859 22:12795652-12795674 GGAGAATGACAAAAGCCCAGAGG + Intergenic
1181049996 22:20233914-20233936 GGTGACTGACACTGTCCCTGAGG - Intergenic
1181506500 22:23361828-23361850 GGGGAGTGTCCAAGGCCCTGTGG - Intergenic
1181954656 22:26579517-26579539 GGTGGAAGACAGAGGCCCTGTGG - Intronic
1182415599 22:30219222-30219244 GCGGAATGGCACAGCCACTGCGG + Intergenic
1183276025 22:36898711-36898733 GGTGAAGAACACCGGCCCTGGGG - Intergenic
1183405351 22:37627804-37627826 GGGGAATGGAGGAGGCCCTGGGG + Intronic
1184246644 22:43239150-43239172 GGGGAATGACACCATTCCTGTGG + Intronic
1184477077 22:44727727-44727749 AGAGAAGGACACAGGCCCGGAGG + Intronic
1184764022 22:46562193-46562215 GCTGAATGACCCAGGCCCTCTGG - Intergenic
1185216058 22:49600608-49600630 GCGGCCTCACACAGGCCCTGGGG + Intronic
950426124 3:12925654-12925676 GTGGAATGACCCATGCTCTGGGG - Intronic
950475268 3:13210811-13210833 GGGGAAGGAGGCAGGCCCTGAGG + Intergenic
951728122 3:25782866-25782888 GGGGAATGACACGCGCGGTGCGG + Intronic
951838868 3:27011987-27012009 AGAGAATGACATATGCCCTGAGG - Intergenic
952051022 3:29384796-29384818 GAGGAATGTCAGAGGCCCTCAGG - Intronic
953470196 3:43159679-43159701 GGGAGGTGACACAGCCCCTGGGG - Intergenic
954369902 3:50164729-50164751 TGGGAATGGCAGTGGCCCTGTGG + Intronic
954375712 3:50193201-50193223 GGGGAAGGACCCAGACCCAGGGG - Intronic
954605010 3:51902711-51902733 GGGGAATGACACAGCAGCAGGGG + Intronic
957517853 3:81279013-81279035 GTGGGATGACACATGACCTGTGG - Intergenic
957975155 3:87433734-87433756 GGGGAATGACACAGCAGCAGGGG + Intergenic
960720898 3:120623474-120623496 GGGGAATGACACAGCAGCAGGGG - Intergenic
961788194 3:129360047-129360069 GGGGAAGGAGGCAGGCCCTGAGG - Intergenic
962145607 3:132836598-132836620 GGGGAATAACAAAGGTCCTGAGG - Intergenic
963139032 3:141932601-141932623 GGGAAGTGTCACAAGCCCTGAGG - Intergenic
963312909 3:143728398-143728420 GTGGATGGACACAGGCCTTGAGG + Intronic
963371124 3:144401816-144401838 GGGGAAAGAGACAGTCACTGTGG - Intergenic
964160616 3:153640903-153640925 TGGGAGTGAGACAGGCCCTTCGG + Intergenic
965075337 3:163968250-163968272 GAAGGAGGACACAGGCCCTGGGG + Intergenic
965680947 3:171250612-171250634 TGGGAACAACACAGGCCCTGTGG + Intronic
1202741373 3_GL000221v1_random:59556-59578 GGAGAATGACAAAAGCCCAGAGG + Intergenic
969657285 4:8505524-8505546 GGGGCATGAGTCACGCCCTGTGG + Intergenic
969927541 4:10599187-10599209 AGGCATTGACCCAGGCCCTGGGG - Intronic
970238282 4:13981155-13981177 GGGGAATGCCAGAAGCCTTGTGG + Intergenic
970399456 4:15703428-15703450 GGGCAATGAGAGAGGCCTTGAGG + Intronic
971066836 4:23042501-23042523 GGGGAATGACACAGCAGCAGGGG + Intergenic
971072785 4:23113712-23113734 GGGGCTTTACACAGACCCTGAGG - Intergenic
971845459 4:31912999-31913021 GGTGAATGACAGAGACTCTGTGG - Intergenic
972048786 4:34702448-34702470 TGGGAATGAGACTGGCCCTTTGG + Intergenic
972784411 4:42313776-42313798 GGGGAATGACACAGCAGCAGGGG + Intergenic
972785232 4:42320431-42320453 GGGGAATGACACAGCAGCAGGGG + Intergenic
973362928 4:49181625-49181647 GGAGAATGACAAAAGCCCAGAGG - Intergenic
973398171 4:49615229-49615251 GGAGAATGACAAAAGCCCAGAGG + Intergenic
976011371 4:80493352-80493374 GGGGAATGACACAGTAGCAGGGG - Intronic
976041948 4:80897770-80897792 GGGGAAAGACACAGGGCATAAGG - Intronic
976219777 4:82747003-82747025 GTGGAATGACACAGGCACCAAGG + Intronic
977531250 4:98202644-98202666 GGGGAATGACACAGCAGCAGGGG + Intergenic
977976146 4:103269013-103269035 TGGGAATGACATAGGCCTTTAGG - Intergenic
978314445 4:107419852-107419874 GGGGAATGACACAGCAGCAGGGG + Intergenic
979619843 4:122786646-122786668 GGGGAATGACACAGCATCAGGGG + Intergenic
980341156 4:131548983-131549005 GGGGAATGACACAGCAGCAGGGG + Intergenic
981356572 4:143796415-143796437 GGGGATTCTCACAGGCTCTGAGG + Intergenic
981368109 4:143927014-143927036 GGGGATTCTCACAGGCTCTGAGG + Intergenic
981377901 4:144037286-144037308 GGGGATTCTCACAGGCTCTGAGG + Intergenic
982087798 4:151853945-151853967 GGGGAAGGACACCTGCCCAGTGG + Intergenic
983973924 4:173909193-173909215 GGGGAATGCTACTGGCCTTGGGG - Intergenic
984876898 4:184376842-184376864 GGAAAATAACATAGGCCCTGAGG + Intergenic
1202760284 4_GL000008v2_random:103132-103154 GGAGAATGACAAAAGCCCAGAGG - Intergenic
985709537 5:1420516-1420538 TGGGAATGCCAGAGCCCCTGTGG + Intronic
985712889 5:1439901-1439923 GGGGAACGACCCCGGCCCTCTGG + Intronic
985926973 5:3026475-3026497 GGGGCACCACACAGGCCCTGTGG - Intergenic
985944237 5:3164142-3164164 GGAGGATGGCACAGGCCCCGAGG - Intergenic
987717843 5:21594764-21594786 TGGGAAGCACAAAGGCCCTGAGG - Intergenic
988723583 5:33903488-33903510 TGGGAGTGAGACAGGCCCTTCGG - Intergenic
990786929 5:59431802-59431824 AAGGAAGGACACAGACCCTGGGG - Intronic
991039945 5:62164835-62164857 TGGGAGTGACATAGGCCATGAGG - Intergenic
992325410 5:75655160-75655182 GGGGGTAGATACAGGCCCTGTGG + Intronic
993250362 5:85513427-85513449 TGGGAATGAGACTGGCCCTTTGG - Intergenic
994082616 5:95724525-95724547 GGGTAAGGGCACAGACCCTGGGG + Intronic
994622634 5:102180966-102180988 GGGGAATGACACAGCAGCAGGGG - Intergenic
995019516 5:107351604-107351626 AGGGAAAGACACAAGCCCTTGGG - Intergenic
995903487 5:117095554-117095576 TGGGAATGACACAAGCTCTTGGG + Intergenic
996101385 5:119449111-119449133 GGGGAATGACACAGCAGCAGGGG + Intergenic
998938321 5:147254626-147254648 GGGGAACGACACAGGAGCAGGGG - Intronic
999202267 5:149824801-149824823 TGGGCCTGACCCAGGCCCTGGGG - Intronic
1000934790 5:167294569-167294591 GGGGAATAAAACTCGCCCTGTGG - Intronic
1001530415 5:172457364-172457386 GCGAAATGCCACAGCCCCTGTGG - Intergenic
1002294250 5:178221247-178221269 GGGGAACAACAAAGGCCCAGTGG - Intronic
1003261549 6:4521198-4521220 GGGGGATGACACTGACTCTGAGG - Intergenic
1004774817 6:18832056-18832078 GGGGAAAGACACAAGCTCTTGGG - Intergenic
1006113102 6:31760661-31760683 AGGGAAGGAGACAGGGCCTGGGG - Intronic
1006140732 6:31928062-31928084 GGGGATGGGTACAGGCCCTGGGG - Exonic
1006456781 6:34136606-34136628 GGGGAAGGACAGATGCCATGGGG + Intronic
1007479241 6:42139217-42139239 GGGGAATGTCACAGACTCAGGGG + Intronic
1007709252 6:43811445-43811467 GGGGTAAGTCACAGGACCTGAGG - Intergenic
1007784602 6:44272407-44272429 GGGGAATGAGACTGGGCCTGGGG + Intronic
1008280200 6:49587373-49587395 GGGGAATGACACAGCAGCAGGGG - Intergenic
1009624818 6:66126142-66126164 GGAGAATGACATAGACTCTGAGG + Intergenic
1011365859 6:86581910-86581932 GGGGAATGACACAGCAGCAGAGG - Intergenic
1012155928 6:95819793-95819815 TGGGAATGAGACTGGCCCTTTGG + Intergenic
1016139057 6:140585854-140585876 GAGGAAGGACACAGACCCTGGGG + Intergenic
1016270686 6:142286203-142286225 GGAGTATGACATGGGCCCTGGGG - Intergenic
1016893642 6:149032195-149032217 GGAGGGTGACACAGGCCCTCCGG - Intronic
1017120844 6:151022650-151022672 GGGGGAGGTCAAAGGCCCTGAGG - Intronic
1018288335 6:162264619-162264641 GGGGAGGGGCACAGGGCCTGGGG - Intronic
1019014096 6:168867345-168867367 GGGGACAGACAGAGCCCCTGGGG - Intergenic
1019991876 7:4697500-4697522 AGGAAATAACACAGGCTCTGGGG - Intronic
1022535196 7:31094046-31094068 GGGGACTAGCACAGGGCCTGGGG + Intronic
1023566291 7:41526732-41526754 GAGGCAGGACACAGTCCCTGGGG + Intergenic
1023798077 7:43810459-43810481 GGGGAATGACACAGCAGCAGGGG + Intergenic
1024587512 7:50854560-50854582 GAGGACAGACACAGGCTCTGGGG + Intergenic
1026799259 7:73388546-73388568 GGGGAATGACACAGCAGCAGGGG - Intergenic
1027941362 7:84685271-84685293 AGAGCATGACACAGGGCCTGAGG - Intergenic
1028333445 7:89624430-89624452 GGGGAATGACACAGCAGCAGGGG + Intergenic
1029278159 7:99419860-99419882 GGGGGAAGAGCCAGGCCCTGAGG - Exonic
1032215161 7:129952245-129952267 GAGGAAAGTCACAGGCTCTGGGG + Intronic
1032785047 7:135194063-135194085 TGGGAGTCACCCAGGCCCTGTGG - Intronic
1033096800 7:138439334-138439356 GGGGAATGACACAGCAGCAGGGG - Intergenic
1033765409 7:144484380-144484402 GTAAAATGACACAGCCCCTGTGG + Intronic
1034826605 7:154270869-154270891 GGGGGAAGACACAGGGGCTGAGG - Intronic
1035017232 7:155777239-155777261 TGAGTGTGACACAGGCCCTGGGG + Exonic
1035173423 7:157033581-157033603 GGGGCCTGGCACAGGTCCTGCGG - Intergenic
1035325709 7:158064643-158064665 GGGAGATGACAGAGGCCCTGAGG - Intronic
1036572729 8:9995980-9996002 GGGGAAGGGCACATGCTCTGGGG + Intergenic
1037612692 8:20489675-20489697 GGTGAATTAAACAAGCCCTGGGG + Intergenic
1037965367 8:23129831-23129853 AGTGACTGACACAAGCCCTGAGG - Intergenic
1038315380 8:26480253-26480275 GGAGAATGAAGCAGGCCCAGAGG + Intronic
1038799465 8:30736306-30736328 GGGAAATCACACATGCACTGAGG + Intronic
1040320465 8:46293221-46293243 GGGGCATTTCAGAGGCCCTGAGG - Intergenic
1041445938 8:57950790-57950812 GGGGAATGCCACAGGAGCTGTGG + Intergenic
1041484393 8:58358778-58358800 GGGGCATGGCAAAGTCCCTGCGG + Intergenic
1043322541 8:79007705-79007727 GGGTACTGACACAGGCCAAGAGG + Intergenic
1045295920 8:100871724-100871746 TGGGAAGGACCAAGGCCCTGTGG + Intergenic
1046935999 8:119886408-119886430 GGGGAATGACACAAGCCAAGGGG + Intronic
1047120304 8:121895962-121895984 GTGCAAAGAAACAGGCCCTGTGG + Intergenic
1047749368 8:127868237-127868259 AGGGAATGCCACAGACCCTGAGG - Intergenic
1048319613 8:133388103-133388125 CTGGAATGGCCCAGGCCCTGGGG - Intergenic
1048388289 8:133934525-133934547 GGGGAATGACACAGCAGCAGGGG + Intergenic
1048414428 8:134210439-134210461 TGGAAATGACACAGGCGCTTTGG - Intergenic
1048930970 8:139315232-139315254 GGGGACAGAGTCAGGCCCTGAGG - Intergenic
1049636218 8:143690976-143690998 GGGGAATGGGAGTGGCCCTGCGG - Intronic
1056646770 9:88419374-88419396 GGGGAATGACACAGCAGCAGGGG + Intronic
1057354402 9:94322134-94322156 AGTGAATGACAGAGGCCCGGTGG - Intronic
1057517903 9:95737344-95737366 GGGGAGTGACAGAGCCCCTGGGG - Intergenic
1057518034 9:95738095-95738117 GGGGAAAGAAACAGGCCCCCCGG + Intergenic
1057653360 9:96935501-96935523 AGTGAATGACAGAGGCCCGGTGG + Intronic
1058641965 9:107096468-107096490 TGGGAAAGACTCAGGCCCAGAGG - Intergenic
1059205004 9:112456365-112456387 GAGGAATGACACAGGCCCACTGG - Intronic
1060627799 9:125129149-125129171 AGGGAATGAGACAGGCACAGTGG + Intronic
1060893398 9:127202583-127202605 TGGCAAGGACACAGGGCCTGTGG + Intronic
1061138605 9:128751025-128751047 GCAGAAGGACACAGGCTCTGGGG + Intronic
1061232619 9:129323569-129323591 GGGGGAAGACCCAGGCTCTGAGG - Intergenic
1061838158 9:133342671-133342693 GGGGCCTCACACAGCCCCTGTGG - Intronic
1061920899 9:133781790-133781812 GGGCAAGGACACAGGCCCCTGGG + Intronic
1062399631 9:136366698-136366720 GGGGGTTGACACAGGCATTGCGG + Intronic
1062518102 9:136946029-136946051 GGGGGATGACGCAGCCACTGTGG + Intronic
1062543602 9:137052258-137052280 GGAGAACGACACAGGCATTGTGG - Exonic
1062612622 9:137381867-137381889 GGCGAATGCCACATGCCCAGTGG - Intronic
1203751326 Un_GL000218v1:83460-83482 GGAGAATGACAAAAGCCCAGAGG + Intergenic
1203482661 Un_GL000224v1:20894-20916 GGAGAATGACAAAAGCCCAGAGG - Intergenic
1203710011 Un_KI270742v1:89480-89502 GGAGAATGACAAAAGCCCAGAGG + Intergenic
1203541060 Un_KI270743v1:88026-88048 GGAGAATGACAAAAGCCCAGAGG - Intergenic
1186327335 X:8494100-8494122 GGTGAATGACATAGGCATTGTGG - Intergenic
1186514553 X:10156854-10156876 GGCGAATGACACTGGCACGGCGG + Intergenic
1186853501 X:13603376-13603398 GAGGATGGACACAGGCACTGTGG - Exonic
1187452185 X:19408233-19408255 GGGGATTTACAAAGGGCCTGAGG - Intronic
1188852643 X:35150800-35150822 GAGGTATGACACAGGCCCCCAGG - Intergenic
1189034083 X:37478620-37478642 GGGGAATGACACAGCAGCAGGGG + Intronic
1189034820 X:37484639-37484661 GGGGAATGACACAGCAGCAGGGG + Intronic
1189110935 X:38287840-38287862 AGGTAATGACACAGGCCAGGTGG - Exonic
1189700912 X:43715831-43715853 GGGATGTGACACAGGCACTGTGG + Intronic
1189884096 X:45522364-45522386 GGTGAATGAACCAGACCCTGTGG - Intergenic
1189921118 X:45904092-45904114 GGGAAAAGACATAGCCCCTGTGG + Intergenic
1190076574 X:47321589-47321611 GGGGAATCACGCAAGCCCAGGGG - Intergenic
1190395432 X:49977207-49977229 GGGAATTGAAACAGGCGCTGAGG + Intronic
1191755626 X:64589534-64589556 GGGAAATAACTGAGGCCCTGTGG - Intergenic
1191889709 X:65927463-65927485 GGGGAATGACACAGCAGCAGGGG - Intergenic
1192363936 X:70455540-70455562 GAGGCAGGACAGAGGCCCTGGGG - Intronic
1193145967 X:78076062-78076084 GGGGAATGACACAGCAGCAGGGG - Intronic
1197363546 X:125536317-125536339 TGGGAATGAGACTGGCCCTTTGG + Intergenic
1199278184 X:145970674-145970696 GGGGAATGACACAGCAGCAGGGG + Intergenic
1201434671 Y:13943978-13944000 GGTGAATGACATAGGCATTGTGG + Intergenic
1201474199 Y:14363271-14363293 GGGGAATGACACAGCAGCAGGGG - Intergenic
1201900849 Y:19045164-19045186 GGGGAATGACACAGCAGCAGGGG + Intergenic