ID: 1152895730

View in Genome Browser
Species Human (GRCh38)
Location 17:82910058-82910080
Sequence CTGGAAACCCAGATGAGCCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 332
Summary {0: 1, 1: 0, 2: 2, 3: 21, 4: 308}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152895730_1152895734 -5 Left 1152895730 17:82910058-82910080 CCCAGGCTCATCTGGGTTTCCAG 0: 1
1: 0
2: 2
3: 21
4: 308
Right 1152895734 17:82910076-82910098 TCCAGCCTTTGGCTATTGTAGGG 0: 1
1: 0
2: 1
3: 25
4: 193
1152895730_1152895733 -6 Left 1152895730 17:82910058-82910080 CCCAGGCTCATCTGGGTTTCCAG 0: 1
1: 0
2: 2
3: 21
4: 308
Right 1152895733 17:82910075-82910097 TTCCAGCCTTTGGCTATTGTAGG 0: 1
1: 0
2: 6
3: 30
4: 163
1152895730_1152895737 30 Left 1152895730 17:82910058-82910080 CCCAGGCTCATCTGGGTTTCCAG 0: 1
1: 0
2: 2
3: 21
4: 308
Right 1152895737 17:82910111-82910133 ACATCTAGACGTACAAGTCTTGG 0: 1
1: 0
2: 0
3: 7
4: 58

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152895730 Original CRISPR CTGGAAACCCAGATGAGCCT GGG (reversed) Intronic
900377357 1:2361699-2361721 CTGGAAATGCAGTTGACCCTTGG + Intronic
900622484 1:3593670-3593692 GTGGAAACCCGGGGGAGCCTTGG + Intronic
901533790 1:9869847-9869869 CTAGAAACCCAGATTAGCCCTGG + Intronic
902603549 1:17556122-17556144 CTGGAAACACAGGGGGGCCTGGG + Intronic
903510831 1:23873873-23873895 CTGGAAATACAGAGGAGGCTGGG - Exonic
903589149 1:24441069-24441091 TGGGAAACCCAGATAAGACTTGG + Intronic
904381467 1:30114010-30114032 ATGGAAGGCCAGATGACCCTGGG + Intergenic
904615244 1:31746020-31746042 CTGGACTCCCAGAAGAGCTTTGG + Intronic
905127939 1:35729044-35729066 TTGGAAAACCAGATGGACCTAGG - Intronic
905351340 1:37348634-37348656 CGGGATACACAGATGAACCTGGG - Intergenic
905868943 1:41391951-41391973 GTGGAAACCCAGATGGGAGTTGG - Intergenic
906133543 1:43477925-43477947 CAGGAATTCCAGATCAGCCTGGG - Intergenic
906277155 1:44524868-44524890 CTGCTAACCCCGATAAGCCTTGG - Intronic
907074994 1:51570111-51570133 CTGGTCACCCAGGGGAGCCTCGG - Intergenic
910748822 1:90605187-90605209 CTGAAAGCCCAGGTGGGCCTGGG - Intergenic
911589742 1:99733055-99733077 CAGGAATTCAAGATGAGCCTGGG - Intronic
911701912 1:100963300-100963322 CTGGAAAACCAGAAGAGTGTAGG + Intronic
912400409 1:109386642-109386664 CAGGAATCCCAGACCAGCCTAGG + Intronic
913612970 1:120526269-120526291 ATGAAAACCCAAATTAGCCTGGG - Intergenic
914146724 1:145001810-145001832 CAGGAGTTCCAGATGAGCCTGGG + Intronic
914250410 1:145917709-145917731 CTGGAGAGCCACCTGAGCCTTGG - Exonic
914578217 1:148995979-148996001 ATGAAAACCCAAATTAGCCTGGG + Intronic
914585763 1:149060346-149060368 CTGGAAGCCCAGATGAGGGATGG - Intronic
915124213 1:153652018-153652040 CTGGGGACCCAGCTGAGCTTGGG - Intergenic
916762002 1:167825440-167825462 CAGGAGTTCCAGATGAGCCTGGG + Intronic
918545644 1:185680706-185680728 CCGGAATCCCAGCTGAGCCAAGG + Intergenic
918643352 1:186871668-186871690 CTGGAAGGGCAGATGAGACTAGG + Intronic
919458849 1:197852395-197852417 CTGGAATCCTTGATGATCCTTGG - Intergenic
919748413 1:201022623-201022645 ATGGAACCCCAGATAAGTCTAGG + Intronic
920926686 1:210348169-210348191 CAGGAAATCAAGATCAGCCTGGG + Intronic
921099479 1:211915974-211915996 CTGAATACCCAGCTGAGCTTAGG - Intergenic
922890898 1:229061409-229061431 CAGGAATCCAAGATCAGCCTGGG + Intergenic
924648229 1:245899981-245900003 CTGGAGACCCAGAAGAGCCATGG - Intronic
1064516341 10:16153045-16153067 ATGGATACCCAGAATAGCCTGGG + Intergenic
1069863794 10:71487777-71487799 CTAGACACCCTGGTGAGCCTTGG + Intronic
1070688122 10:78504903-78504925 CTGGAAAGCAAGAGGTGCCTTGG + Intergenic
1070972372 10:80578177-80578199 CAGAAATTCCAGATGAGCCTGGG - Intronic
1073257342 10:102161438-102161460 CAGGAAATTCAGATCAGCCTGGG - Intronic
1073568993 10:104560133-104560155 CAGCAAACACAGATGAGGCTGGG - Intergenic
1074629987 10:115242236-115242258 ATGGAAACCCAGATGTATCTGGG + Intronic
1075083624 10:119399887-119399909 ATGGACATCCAGGTGAGCCTAGG - Intronic
1075587499 10:123668133-123668155 CTGGGAACCCAGGGGAGCCTCGG + Intronic
1075924804 10:126242736-126242758 CTTGAAATCCTGAGGAGCCTGGG - Intronic
1075972392 10:126665730-126665752 GGGGAAACTCAGCTGAGCCTGGG + Intronic
1076497856 10:130909503-130909525 CAGGAAAACCACATGGGCCTCGG + Intergenic
1076982268 11:210918-210940 CTGGAAACCCAGACCAGCCTAGG - Intronic
1077167207 11:1149078-1149100 CTGGAAACCCAGAGGTGCTGGGG - Intergenic
1077833175 11:5898065-5898087 CAGGAATTCCAGATCAGCCTGGG - Intronic
1078147064 11:8729342-8729364 CAGGAAACCAACGTGAGCCTCGG + Intronic
1078858207 11:15223808-15223830 CTGGAAAAACAGATTAGCCAAGG - Intronic
1083811036 11:65107195-65107217 CTGGACACGCAGATGCGCTTGGG + Intronic
1084111112 11:67014740-67014762 CTGAGAACCCAGAGGGGCCTAGG + Intronic
1084948584 11:72652318-72652340 CTGGAGTTCCAGATCAGCCTGGG - Intronic
1085094918 11:73752607-73752629 CAGGAATTCGAGATGAGCCTGGG + Intronic
1086222881 11:84471128-84471150 CTGGCAACCCAGATGGAACTGGG + Intronic
1089305924 11:117526145-117526167 CAGGAAACCCAGAGAGGCCTTGG - Intronic
1089374411 11:117984426-117984448 AGGGAAACCCAGAAGAGACTGGG + Intergenic
1089697745 11:120226361-120226383 CAGGGAACTCAGATGAGGCTGGG - Intronic
1093025493 12:14241593-14241615 CAGGAAACCAAGACCAGCCTGGG + Intergenic
1096504903 12:52086620-52086642 GTGGACACCCAGAGGAGCCGTGG - Intergenic
1097141101 12:56903026-56903048 CTGGAGACCCAGATGACTCTGGG + Intergenic
1099043570 12:77686741-77686763 CTGTAAAGTCAGATGAACCTAGG - Intergenic
1099995315 12:89771736-89771758 CTGGAAAGCCAAATCTGCCTTGG - Intergenic
1100495987 12:95125422-95125444 CAGGAATTCAAGATGAGCCTGGG + Intronic
1101398533 12:104368814-104368836 CTGGAAGCCCAGGTGGGGCTTGG - Intergenic
1101521903 12:105491602-105491624 GTGAAAACACAGATGAACCTGGG - Intergenic
1101579267 12:106027221-106027243 CTTGACACACAGATGAGCCAAGG - Intergenic
1101914484 12:108885515-108885537 CAGGAAAACCATTTGAGCCTAGG + Intronic
1102123690 12:110463227-110463249 CTGGAAATCGAGACCAGCCTGGG + Intronic
1103122232 12:118389954-118389976 CTGCAAACCCAGAAGATCCGTGG - Intronic
1104192812 12:126499529-126499551 CAGGAGATCCAGATCAGCCTGGG + Intergenic
1104943480 12:132405432-132405454 CTGGGAACCCAGGAGAGCCAGGG - Intergenic
1106149590 13:27085955-27085977 CAGGAGATCTAGATGAGCCTAGG + Intronic
1106257348 13:28033453-28033475 CAGGAGTCCCAGATCAGCCTAGG + Intronic
1107303653 13:38994460-38994482 CTGGAGTTCAAGATGAGCCTGGG - Intergenic
1110563785 13:76937625-76937647 CTGGGAAGCCAGATGAGTCATGG - Intergenic
1112306629 13:98280283-98280305 CTGGAAAACCAGCTGATGCTGGG - Intronic
1112743139 13:102496967-102496989 CTGGAATCCAAGACCAGCCTAGG + Intergenic
1113247220 13:108411092-108411114 CTGTAAATACAGATGACCCTTGG + Intergenic
1114079757 14:19193688-19193710 CAGGAGTTCCAGATGAGCCTGGG - Intergenic
1114300372 14:21371083-21371105 CAGGAGTTCCAGATGAGCCTGGG - Intronic
1115262442 14:31468016-31468038 CAGGAATTCAAGATGAGCCTGGG - Intergenic
1115760584 14:36577052-36577074 CTGGGAGCCCAGCGGAGCCTTGG - Intergenic
1116867352 14:50041533-50041555 CCAGAAACTCAGATCAGCCTAGG + Intergenic
1117145697 14:52835207-52835229 CTGGAAACCCAAATGGCCTTGGG + Intergenic
1119179691 14:72597427-72597449 CTGGAAACCCCCAGGAGCCAGGG + Intergenic
1119255420 14:73191754-73191776 CAGGAATTCCAGACGAGCCTGGG - Intronic
1119662891 14:76464270-76464292 CTGGAAGCCCAGCCCAGCCTTGG + Intronic
1120699683 14:87685302-87685324 CAGGAGTTCCAGATGAGCCTGGG - Intergenic
1122189139 14:100026040-100026062 CAGGAGCCCCAGATCAGCCTGGG + Intronic
1122246946 14:100410088-100410110 CTGGAAACTCAGATGGGGTTTGG - Intronic
1122485240 14:102075267-102075289 CTGGAAGCAGAGCTGAGCCTAGG + Intergenic
1123870787 15:24570284-24570306 CTGTAATCCCAGACTAGCCTGGG - Intergenic
1126279275 15:46923974-46923996 CAGGAAATCCAGACAAGCCTGGG + Intergenic
1127688557 15:61372186-61372208 CTGGAGGCCCAGGTGACCCTTGG - Intergenic
1129189862 15:73930937-73930959 CAGGAGACCCAGCTGGGCCTGGG - Intronic
1129225768 15:74169552-74169574 CTAGGAACCCAGGTGAGCCTTGG - Intergenic
1129323314 15:74786777-74786799 CTGTAGCCCCAGATGACCCTAGG + Intronic
1131232790 15:90671788-90671810 CTGGAAATCCAGGTGAGCCATGG - Intergenic
1131348908 15:91678634-91678656 CTGCAAACCTGGATGAGCATGGG - Intergenic
1132559629 16:587465-587487 CAGGGAACCCAGATGGGTCTAGG - Intergenic
1132656716 16:1044550-1044572 CTGGGCTCCCAGAGGAGCCTTGG - Intergenic
1136034583 16:27529541-27529563 CTGAAAACCAAAATGATCCTAGG + Intronic
1136057101 16:27698616-27698638 GTGGAAACACGGATGAGTCTGGG - Intronic
1137723922 16:50644552-50644574 CTGGAAACCCAGAACCTCCTGGG + Intergenic
1138676991 16:58658630-58658652 CAGGAATCCAAGATCAGCCTGGG + Intergenic
1139607327 16:68028842-68028864 CTTGAATCCCAGCTGTGCCTCGG - Intronic
1140338780 16:74137098-74137120 CAGGAGTTCCAGATGAGCCTGGG + Intergenic
1140446478 16:75032804-75032826 CTTGAGACCCAGACCAGCCTGGG + Intronic
1141122932 16:81375755-81375777 CTGGAACCTGAGATCAGCCTGGG + Intronic
1141391431 16:83667869-83667891 CAGGAATTCAAGATGAGCCTGGG - Intronic
1141615559 16:85207622-85207644 CTGCAGAGCCAGATGAGGCTGGG + Intergenic
1143169714 17:4921476-4921498 CAGGAATCCCAGACCAGCCTGGG - Intergenic
1143516515 17:7421785-7421807 CTTGGAACCCAGAAGGGCCTAGG - Intergenic
1143858239 17:9868624-9868646 TTGGAAGCCCAGATGAGCAGAGG + Intronic
1143964343 17:10746019-10746041 CAGGAATTCAAGATGAGCCTGGG + Intergenic
1144787486 17:17840144-17840166 CTGGAGACCCAGGGGAGCCGGGG + Intergenic
1145905498 17:28514100-28514122 CTGGAAAAGCACTTGAGCCTTGG - Intronic
1145943942 17:28759299-28759321 CTGGAGACCCTGGTGAGCCAGGG + Exonic
1146377871 17:32306826-32306848 CTGGAGAATCAGTTGAGCCTGGG + Intronic
1146471024 17:33125046-33125068 CTGTAAACACAGATGAAGCTTGG + Intronic
1147738248 17:42654569-42654591 CAGGAGTCCGAGATGAGCCTGGG + Intergenic
1147865691 17:43550629-43550651 CTGGAAAATCATTTGAGCCTAGG - Intronic
1148933663 17:51147760-51147782 CTGGAATTCCAGACCAGCCTGGG - Intergenic
1149676257 17:58465228-58465250 CAGGAAATTGAGATGAGCCTGGG - Intronic
1152699943 17:81813756-81813778 CTGGACGCCCAGCTGAGGCTGGG + Exonic
1152895730 17:82910058-82910080 CTGGAAACCCAGATGAGCCTGGG - Intronic
1153576139 18:6523787-6523809 CTAAGAACCCAGATGAACCTGGG - Intronic
1153792947 18:8596308-8596330 TGGGAAACCCACCTGAGCCTGGG - Intergenic
1154470388 18:14694386-14694408 CAGGAATTCCAGATCAGCCTGGG - Intergenic
1154500948 18:14997761-14997783 CAGGAAACCCACACGAGCCATGG + Intergenic
1155959119 18:31978725-31978747 TGGGAATCCCAGATGAGCCCGGG + Intergenic
1157789438 18:50518273-50518295 CAGGAATCCAAGATGAGCCCGGG - Intergenic
1158390003 18:57037224-57037246 CTGGAAACACAGAGGAAACTGGG - Intergenic
1158601597 18:58860591-58860613 CTTGAAACCAAGCTAAGCCTAGG - Intergenic
1160006107 18:75070250-75070272 CAGGGAGCCCAGATCAGCCTTGG - Intergenic
1161038441 19:2097801-2097823 CATGAAAACCAGGTGAGCCTGGG + Intronic
1161235303 19:3194964-3194986 CTGGAGTCCAAGATTAGCCTGGG + Intronic
1161960981 19:7522975-7522997 TTGGGAACCCAGCAGAGCCTGGG - Intronic
1162917100 19:13880531-13880553 CTGGAAATCCAGCCGAGCCCGGG - Intronic
1163119421 19:15208103-15208125 CAGGAATTCCAGATAAGCCTGGG + Intergenic
1163351574 19:16779454-16779476 CTGGACACACAGGTGAGACTTGG + Exonic
1163491543 19:17619840-17619862 CTGACAAGCCAGATGGGCCTGGG + Intronic
1163495961 19:17646780-17646802 GGGGAAACCCACATGAGGCTGGG + Intronic
1164893749 19:31849892-31849914 CAGGAATCCAAGATCAGCCTAGG + Intergenic
1166406665 19:42526603-42526625 CTGGTGACCCTGAGGAGCCTGGG - Intronic
1167518340 19:49936741-49936763 CTGGAATTCCAGAGCAGCCTGGG + Intronic
1167820529 19:51923431-51923453 CAGGAAGCCCACTTGAGCCTGGG - Intronic
1168658095 19:58146379-58146401 CAGGAAAACCACTTGAGCCTGGG + Intronic
926251083 2:11155743-11155765 CTGGGAGCCCAGGAGAGCCTCGG + Intronic
928216574 2:29366438-29366460 CTGGGAACCCAGAGAAGCATAGG + Intronic
928311294 2:30212258-30212280 CTGTAAAACCATCTGAGCCTAGG + Intergenic
928330102 2:30351213-30351235 CTGCAAACCGAGAGGAGGCTTGG - Intergenic
928587221 2:32772827-32772849 CTGAAAACCCAGAGGGGACTGGG - Intronic
928930755 2:36621194-36621216 CTGGAATCCCAGCTCAGGCTTGG + Intronic
929029160 2:37634872-37634894 CTGAATATCCAGATGAGCCCTGG - Intergenic
929803663 2:45126030-45126052 CAGGAATTCAAGATGAGCCTGGG + Intergenic
930090762 2:47529783-47529805 CTGGCAACCCTAATGAGCCATGG - Intronic
933660359 2:84922709-84922731 CTGGAGACCCAGGAAAGCCTGGG - Intergenic
934160546 2:89245236-89245258 CTGGAGACCCCTTTGAGCCTTGG - Intergenic
934206731 2:89937202-89937224 CTGGAGACCCCTTTGAGCCTTGG + Intergenic
935256632 2:101315355-101315377 CTGGAGACCTAGATGAGCCTGGG - Intergenic
935667230 2:105523253-105523275 CAGGAGACTCAGTTGAGCCTGGG + Intergenic
936479453 2:112871528-112871550 GTGGAAGCTCAGAGGAGCCTTGG + Intergenic
937196196 2:120159012-120159034 CTGGAAACCAAGAAAATCCTAGG - Intronic
937903474 2:127040114-127040136 CTGGTAACCCAGATGAGCTGCGG - Intergenic
938904471 2:135825507-135825529 CTGGAGAGCTAGAGGAGCCTCGG + Intronic
939558995 2:143711718-143711740 CAGGAATTCCAGATCAGCCTGGG + Intronic
939651251 2:144765293-144765315 ATGGAAACCCAGATTAGCTCTGG - Intergenic
940844903 2:158629854-158629876 CTGTAATCCCAGCTGAGGCTGGG - Intronic
940996745 2:160158017-160158039 CTAGTAACACAGTTGAGCCTGGG - Intronic
942559058 2:177201083-177201105 CAGGAATCCAAGATCAGCCTGGG + Intergenic
946734461 2:222740520-222740542 CTGGAGAACCAGGTGAGTCTTGG + Intergenic
946821687 2:223636200-223636222 CAGGAATCCAAGATCAGCCTGGG + Intergenic
947989872 2:234478209-234478231 CAGGAATTCAAGATGAGCCTGGG + Intergenic
948585261 2:239015264-239015286 CTGGCAACCGAGAGGTGCCTGGG + Intergenic
1169883011 20:10367827-10367849 CTGCAATCCCAGATGTGCTTTGG - Intergenic
1170066291 20:12314252-12314274 CTGGAAACACAGAAAAGCATGGG - Intergenic
1170817654 20:19728406-19728428 CAGGAATTCCAGATCAGCCTGGG + Intergenic
1171183823 20:23110784-23110806 CTGGAAACCCAGGTGTCCCTGGG + Intergenic
1171989433 20:31684486-31684508 CTGGGGACCCAGCTGAGCCCAGG + Intronic
1173517129 20:43672535-43672557 CAGGAGTTCCAGATGAGCCTAGG + Intronic
1174536161 20:51253181-51253203 CTGGAAACCCCAAGAAGCCTGGG + Intergenic
1174795298 20:53517306-53517328 CTGTAAACACAGATGAAGCTTGG - Intergenic
1174811147 20:53646919-53646941 CAGGAGTTCCAGATGAGCCTGGG + Intergenic
1175145772 20:56895157-56895179 CTTAAAACCTAGATGAGGCTGGG - Intergenic
1176284999 21:5014714-5014736 CTGGACACCCATATGCGCCATGG + Intergenic
1176377575 21:6094104-6094126 CCTGAAAGCCAGATGAGCCAGGG - Intergenic
1176804101 21:13463480-13463502 CAGGAATTCCAGATCAGCCTGGG + Intergenic
1177758411 21:25374081-25374103 CTGGAAAGTCAGATTTGCCTGGG - Intergenic
1179240917 21:39591321-39591343 CTGTAGTCCCAGCTGAGCCTGGG + Intronic
1179745900 21:43444140-43444162 CCTGAAAGCCAGATGAGCCAGGG + Intergenic
1179872182 21:44248761-44248783 CTGGACACCCATATGCGCCATGG - Intronic
1180501014 22:15929012-15929034 CAGGAGTTCCAGATGAGCCTGGG + Intergenic
1180953333 22:19730513-19730535 CTTGAACCCCAGATGGGTCTTGG - Intergenic
1180970722 22:19813784-19813806 CAGGAATTCCAGATCAGCCTGGG + Intronic
1181820344 22:25470737-25470759 CAGGAATTCGAGATGAGCCTGGG - Intergenic
1181976043 22:26730690-26730712 ATGGAAACTCACCTGAGCCTTGG + Intergenic
1182546568 22:31080207-31080229 CTGTTAACCCAGAAGAGCCCCGG - Intronic
1184597554 22:45523349-45523371 CTGGACACCCTGAGGTGCCTGGG + Intronic
950249307 3:11450943-11450965 CTTGAAAATCAGATCAGCCTTGG - Intronic
950384776 3:12649789-12649811 CAGGAATTCCAGATCAGCCTGGG + Intronic
952005377 3:28836956-28836978 CTGGAAAACCAGCTGAGACTGGG + Intergenic
952533878 3:34290082-34290104 CAGGACTCCCAGGTGAGCCTGGG - Intergenic
953156663 3:40381339-40381361 CTGGAAACCCAGGAGAGCCCAGG - Intergenic
953568395 3:44052266-44052288 GTGGAAACCCTGAGGACCCTGGG - Intergenic
953886146 3:46715412-46715434 CTTGGAGCCCAGATGAGGCTGGG + Intronic
954178417 3:48862446-48862468 CTGGATTGCCAGATTAGCCTTGG - Intronic
955627495 3:60934143-60934165 TTGGTTACCCAGATGAGGCTGGG + Intronic
955760476 3:62275552-62275574 CTGTAATCCCAGAGCAGCCTGGG + Intronic
956148861 3:66220719-66220741 CTGTAAACCCAGAAGAGGCGTGG - Intronic
956190340 3:66601969-66601991 CAGGAATTCCAGATCAGCCTGGG - Intergenic
959258273 3:104042497-104042519 CTGGAAACCCAGATAGGAATTGG - Intergenic
959399470 3:105882403-105882425 CTGGAAACTCAGTTGGGCCTGGG - Intergenic
959687883 3:109167500-109167522 TTGGAATTCAAGATGAGCCTGGG + Intergenic
959701620 3:109304145-109304167 CTGTAATCCCAGCTGAGACTCGG + Intronic
961072690 3:123949770-123949792 AAGAAAACTCAGATGAGCCTTGG - Intronic
961370450 3:126425439-126425461 CAGCAAACCCATCTGAGCCTGGG - Intronic
961983387 3:131104813-131104835 CTGGAAGCCCAGGGGAGCCGGGG + Intronic
963002860 3:140699411-140699433 CTGGAAAGCAATATGAGCCTGGG + Intronic
963062399 3:141235240-141235262 CTTGAAAGCCAGCTGAGACTTGG + Intronic
963623961 3:147647585-147647607 CTGTAAGCCCAGCTGAGGCTGGG - Intergenic
963714769 3:148790537-148790559 TTGGAAACCCAGATTGGCCCTGG + Intergenic
963961998 3:151320050-151320072 CTAGAAACCAAGGTAAGCCTTGG - Intronic
969150545 4:5165422-5165444 CTTGAAACCCAGAAGCGCCATGG + Intronic
969502448 4:7561339-7561361 CTGGAAGTCCAGACTAGCCTGGG + Intronic
969840439 4:9877809-9877831 CAGCAGACCCAGAAGAGCCTGGG - Intronic
971125124 4:23745537-23745559 CTGGGATCCCAGACAAGCCTTGG + Intergenic
971828790 4:31663111-31663133 TTAGAAACCCAGCAGAGCCTAGG + Intergenic
972184994 4:36517915-36517937 CTGTAAATTCAGATAAGCCTGGG + Intergenic
972536011 4:40000466-40000488 CTGTAATCCCAGCTGAGGCTGGG + Intergenic
973050595 4:45591435-45591457 TAGGAGACCAAGATGAGCCTGGG + Intergenic
973545495 4:51977476-51977498 CAGGAATCCAAGATCAGCCTGGG + Intergenic
974907345 4:68074886-68074908 CAGGAGTTCCAGATGAGCCTGGG + Intronic
975177875 4:71308840-71308862 CTGGAACCCCAGTGGTGCCTAGG + Intronic
976500894 4:85787828-85787850 CTGAAAACCCAGATCACACTGGG + Intronic
977728361 4:100323401-100323423 CTGGAGTTCCAGATAAGCCTGGG - Intergenic
979662944 4:123279291-123279313 CTGTAATCCCAGCTGAGGCTGGG + Intronic
981578633 4:146230224-146230246 CTGGATACCCAGAGGGGCCTGGG - Intergenic
981646775 4:147007429-147007451 GTGGATTCCCAGAAGAGCCTTGG - Intergenic
985520300 5:371016-371038 CTGGAGACCCAGGAGAGCCGAGG + Intronic
986108918 5:4691997-4692019 CTCGAAACCCAGATGTGGTTTGG + Intergenic
986294717 5:6428367-6428389 CTGGAAACCCCCTTGAGACTAGG + Intergenic
987014645 5:13805588-13805610 CTGGACACTCACCTGAGCCTTGG - Intronic
987023755 5:13902314-13902336 CTTGAAAGCCAGATCAGCCATGG + Intronic
990170628 5:53045030-53045052 ATGAAAACCAACATGAGCCTCGG + Exonic
992055885 5:72988998-72989020 CTGGAATTCCAGATTAGCCTGGG + Intronic
992545092 5:77806148-77806170 CAGGAATTCAAGATGAGCCTGGG - Intronic
993782451 5:92084681-92084703 CTAGAATGCCACATGAGCCTGGG - Intergenic
994124306 5:96152385-96152407 CCGGAAACCCAGAGAAGCCTGGG - Intergenic
995167096 5:109056416-109056438 GTCAAAACACAGATGAGCCTGGG + Intronic
999246721 5:150158962-150158984 CTGGGAACCCAGTCCAGCCTTGG + Intergenic
1000351797 5:160358166-160358188 CTGGAGTCCCAGAGGAGTCTTGG + Intronic
1004335008 6:14756503-14756525 CTGGAAGCCTAGGAGAGCCTTGG - Intergenic
1004512136 6:16291700-16291722 CGGGAGTTCCAGATGAGCCTAGG + Intronic
1004871253 6:19906823-19906845 CTGGAAGCCCAGCAGAGCCTGGG - Intergenic
1004952225 6:20686314-20686336 CTGTAAACACAGATGAAGCTTGG - Intronic
1005051251 6:21685874-21685896 CTGTAAACACAGATGAAGCTTGG - Intergenic
1006787630 6:36679087-36679109 CTGGAAACCCAGCTGGGGCGAGG + Intronic
1006902194 6:37510469-37510491 CTGGAGAGACAGATGTGCCTGGG + Intergenic
1011546385 6:88486200-88486222 CGGGAAAGCAAGATGTGCCTGGG + Intergenic
1011703701 6:89980373-89980395 CTGGACACACACATGAGCATGGG + Intronic
1012765516 6:103362706-103362728 TTGCAAACACATATGAGCCTAGG - Intergenic
1013333579 6:109132073-109132095 CTTCAAACCCACATGAGCATCGG - Intronic
1014170491 6:118274072-118274094 CTGGATTCCCCGATGAGCCTGGG - Intronic
1014723855 6:124952348-124952370 CAGGAAACTCACCTGAGCCTTGG + Intergenic
1018831688 6:167448508-167448530 CTGGAAGCCCCCATGAGCCAGGG + Intergenic
1019688415 7:2395514-2395536 AGAGAAACCCAGAGGAGCCTGGG - Intergenic
1020988708 7:15169048-15169070 GTGGATAACCAGATGAGCATTGG + Intergenic
1021447299 7:20747361-20747383 CGGGAGACTCAGGTGAGCCTGGG - Intronic
1022159247 7:27692386-27692408 CTAGAAATCCAGATCAGCCTGGG + Intergenic
1023789548 7:43742354-43742376 CAGGAATCCAAGATCAGCCTAGG + Intergenic
1023940410 7:44765599-44765621 CTTGAACCTCAGATGACCCTGGG + Intronic
1026319444 7:69256194-69256216 CTTGAGTCCAAGATGAGCCTGGG + Intergenic
1026902766 7:74046206-74046228 CTGGAATCCCAGGTGAGGCAAGG + Exonic
1027515352 7:79135730-79135752 CGGGAGTCCGAGATGAGCCTGGG + Intronic
1028556125 7:92126995-92127017 TTGGAAAGCCAGATGATCATTGG - Intronic
1029111414 7:98214683-98214705 CTGAAAGCCCAGAAGAGCCTCGG + Exonic
1029161057 7:98552221-98552243 CAGGAAGCCCACCTGAGCCTTGG - Intergenic
1029453946 7:100657848-100657870 CTGGGAGCCCAGAAGAACCTGGG - Intergenic
1031828739 7:126600234-126600256 CTGGAAATACAGTTGACCCTTGG + Intronic
1032369386 7:131331238-131331260 CTGGAAAACTATATGACCCTGGG - Intronic
1032860300 7:135871911-135871933 CTGTAAAACCATATGGGCCTGGG + Intergenic
1036963542 8:13271883-13271905 CTGGAACCCAAGACCAGCCTGGG - Intronic
1038344383 8:26718768-26718790 CTGGAGACCCAGGAGAGCCAGGG + Intergenic
1039838176 8:41274108-41274130 CTGGAGAACCAGAGAAGCCTTGG - Intronic
1040955312 8:52974042-52974064 CTGGAGACCCAGGGGAGCCAGGG - Intergenic
1042510611 8:69607570-69607592 CTGGAGTTCCAGATCAGCCTGGG - Intronic
1042529765 8:69803069-69803091 CTGTAATCCCAGATCAGCCTGGG + Intronic
1043456398 8:80416452-80416474 CAGGAATTCCAGATCAGCCTGGG + Intergenic
1044086204 8:87945125-87945147 CTGGAAACACAGAAGAAACTTGG + Intergenic
1045471212 8:102513984-102514006 CTGGAATCCTAGCTAAGCCTGGG - Intergenic
1046298454 8:112254286-112254308 GTGAAAACCCAGGTGTGCCTCGG - Exonic
1047243127 8:123112062-123112084 CAGGAGATCCAGATGAGCCTGGG - Intronic
1047770159 8:128024412-128024434 CAGGAATTCCAGATCAGCCTGGG + Intergenic
1047939642 8:129816587-129816609 CTGGAAACCCAGGGGAGTCAGGG + Intergenic
1048848932 8:138626198-138626220 CGGGTAATCCAGATGGGCCTTGG + Exonic
1052829161 9:33201042-33201064 CTGGCAATCCAAATGAGCTTAGG - Intergenic
1053293442 9:36897131-36897153 CTGGAATGGCAGATGTGCCTGGG + Intronic
1054350509 9:64014725-64014747 CTCGAAACCAGGGTGAGCCTCGG - Intergenic
1057443629 9:95098950-95098972 CAGGAAACCTAGATGTGCCCTGG - Intergenic
1058698660 9:107582663-107582685 CAGGAAGACCACATGAGCCTAGG - Intergenic
1059072144 9:111149117-111149139 TTGGACAACCAGATGGGCCTAGG - Intergenic
1059438996 9:114292173-114292195 CTGGAAACCAGGGGGAGCCTGGG + Exonic
1061203028 9:129148127-129148149 CAGGAAACCCAGCAGAGCCAAGG - Exonic
1061515156 9:131085501-131085523 CTGCAAACCCGGCTGAGGCTGGG - Intronic
1062495517 9:136829761-136829783 CTGAAAACCCATCTGAGACTTGG + Intronic
1062590956 9:137274463-137274485 CTGGGGACCCAGGTGAGGCTGGG + Intergenic
1187392491 X:18895289-18895311 CTGGAAACCCATATGAGGGCTGG + Intronic
1187653918 X:21447719-21447741 CTGGAGACACAGAAGAGCATGGG - Intronic
1187864735 X:23713821-23713843 CAGGAAAGCGAGATCAGCCTAGG + Intronic
1188854239 X:35172158-35172180 CTGGAAAACCAAATGACTCTTGG - Intergenic
1189636981 X:43021774-43021796 CTGGAGTTCAAGATGAGCCTGGG - Intergenic
1191857742 X:65640898-65640920 CAGGAGTCCCAGATCAGCCTGGG + Intronic
1192117970 X:68429513-68429535 CAGGAATTCCAGATCAGCCTGGG + Intronic
1192577744 X:72256377-72256399 CTGGAGACCCAGGAGAGCCAAGG + Intronic
1194722231 X:97354021-97354043 CAGGAAAACAAGATAAGCCTGGG - Intronic
1199412626 X:147542401-147542423 CTGCAAAGCCAGAGTAGCCTTGG + Intergenic
1200013616 X:153140709-153140731 CTGGAAACTTAGCTGAGGCTGGG + Intergenic
1200025985 X:153259209-153259231 CTGGAAACTTAGCTGAGGCTGGG - Intergenic
1200685214 Y:6251958-6251980 CAGGAGTTCCAGATGAGCCTGGG - Intergenic
1200990740 Y:9343228-9343250 CAGGAGTTCCAGATGAGCCTGGG - Intergenic
1200993400 Y:9363542-9363564 CAGGAGTTCCAGATGAGCCTGGG - Intronic
1200996062 Y:9383816-9383838 CAGGAGTTCCAGATGAGCCTGGG - Intergenic
1201001233 Y:9472695-9472717 CAGGAGTTCCAGATGAGCCTGGG - Intronic
1201003897 Y:9493026-9493048 CAGGAGTTCCAGATGAGCCTGGG - Intergenic
1201006551 Y:9513307-9513329 CAGGAGTTCCAGATGAGCCTGGG - Intergenic
1201009207 Y:9533613-9533635 CAGGAGTTCCAGATGAGCCTGGG - Intergenic
1201011804 Y:9554450-9554472 CAGGAGTTCCAGATGAGCCTGGG - Intergenic
1201151686 Y:11098411-11098433 CTCGAAACCAGGGTGAGCCTCGG - Intergenic
1201374523 Y:13302529-13302551 CAGGATACTGAGATGAGCCTCGG - Intronic
1201488133 Y:14512863-14512885 CTGGAATTCCAGGTGAGCGTGGG + Intergenic