ID: 1152896469

View in Genome Browser
Species Human (GRCh38)
Location 17:82914217-82914239
Sequence CAGAGCACCGAGAACCCGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 106
Summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 96}

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152896469_1152896474 -4 Left 1152896469 17:82914217-82914239 CCATCCGGGTTCTCGGTGCTCTG 0: 1
1: 0
2: 1
3: 8
4: 96
Right 1152896474 17:82914236-82914258 TCTGCTCTGAAGGATGGTGGAGG 0: 1
1: 0
2: 1
3: 26
4: 280
1152896469_1152896476 3 Left 1152896469 17:82914217-82914239 CCATCCGGGTTCTCGGTGCTCTG 0: 1
1: 0
2: 1
3: 8
4: 96
Right 1152896476 17:82914243-82914265 TGAAGGATGGTGGAGGGCTGTGG 0: 1
1: 0
2: 6
3: 68
4: 673
1152896469_1152896478 15 Left 1152896469 17:82914217-82914239 CCATCCGGGTTCTCGGTGCTCTG 0: 1
1: 0
2: 1
3: 8
4: 96
Right 1152896478 17:82914255-82914277 GAGGGCTGTGGTCTGTTGTTGGG 0: 1
1: 0
2: 0
3: 24
4: 176
1152896469_1152896479 16 Left 1152896469 17:82914217-82914239 CCATCCGGGTTCTCGGTGCTCTG 0: 1
1: 0
2: 1
3: 8
4: 96
Right 1152896479 17:82914256-82914278 AGGGCTGTGGTCTGTTGTTGGGG 0: 1
1: 0
2: 0
3: 21
4: 284
1152896469_1152896482 24 Left 1152896469 17:82914217-82914239 CCATCCGGGTTCTCGGTGCTCTG 0: 1
1: 0
2: 1
3: 8
4: 96
Right 1152896482 17:82914264-82914286 GGTCTGTTGTTGGGGGTGCTGGG 0: 1
1: 0
2: 1
3: 21
4: 255
1152896469_1152896473 -7 Left 1152896469 17:82914217-82914239 CCATCCGGGTTCTCGGTGCTCTG 0: 1
1: 0
2: 1
3: 8
4: 96
Right 1152896473 17:82914233-82914255 TGCTCTGCTCTGAAGGATGGTGG 0: 1
1: 0
2: 1
3: 34
4: 393
1152896469_1152896481 23 Left 1152896469 17:82914217-82914239 CCATCCGGGTTCTCGGTGCTCTG 0: 1
1: 0
2: 1
3: 8
4: 96
Right 1152896481 17:82914263-82914285 TGGTCTGTTGTTGGGGGTGCTGG 0: 1
1: 0
2: 2
3: 15
4: 320
1152896469_1152896475 -3 Left 1152896469 17:82914217-82914239 CCATCCGGGTTCTCGGTGCTCTG 0: 1
1: 0
2: 1
3: 8
4: 96
Right 1152896475 17:82914237-82914259 CTGCTCTGAAGGATGGTGGAGGG 0: 1
1: 0
2: 1
3: 23
4: 266
1152896469_1152896472 -10 Left 1152896469 17:82914217-82914239 CCATCCGGGTTCTCGGTGCTCTG 0: 1
1: 0
2: 1
3: 8
4: 96
Right 1152896472 17:82914230-82914252 CGGTGCTCTGCTCTGAAGGATGG 0: 1
1: 0
2: 0
3: 10
4: 131
1152896469_1152896483 30 Left 1152896469 17:82914217-82914239 CCATCCGGGTTCTCGGTGCTCTG 0: 1
1: 0
2: 1
3: 8
4: 96
Right 1152896483 17:82914270-82914292 TTGTTGGGGGTGCTGGGTGCAGG 0: 1
1: 0
2: 4
3: 55
4: 526
1152896469_1152896477 14 Left 1152896469 17:82914217-82914239 CCATCCGGGTTCTCGGTGCTCTG 0: 1
1: 0
2: 1
3: 8
4: 96
Right 1152896477 17:82914254-82914276 GGAGGGCTGTGGTCTGTTGTTGG 0: 1
1: 0
2: 2
3: 35
4: 1054
1152896469_1152896480 17 Left 1152896469 17:82914217-82914239 CCATCCGGGTTCTCGGTGCTCTG 0: 1
1: 0
2: 1
3: 8
4: 96
Right 1152896480 17:82914257-82914279 GGGCTGTGGTCTGTTGTTGGGGG 0: 1
1: 0
2: 3
3: 15
4: 258

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152896469 Original CRISPR CAGAGCACCGAGAACCCGGA TGG (reversed) Intronic
900217604 1:1490037-1490059 CAGAGGCCCGAGAAGCCGGGCGG + Intronic
901423862 1:9168825-9168847 CAGAGTACCAGGACCCCGGATGG - Intergenic
901787234 1:11632782-11632804 CAGAGCACAGAGAGCCGGCAGGG + Intergenic
903906766 1:26693384-26693406 CCGAGCAGCGAGACCCCGGCTGG - Intergenic
911596935 1:99808693-99808715 AAGAGCACAGAGAACCTAGAGGG + Intergenic
912933614 1:113984613-113984635 AAGGGCACCAAGAACCAGGAGGG + Intergenic
914448628 1:147771737-147771759 CAGAGCAGAGAGTACCAGGAGGG - Intronic
914958934 1:152189162-152189184 CACAGCCCCGAGAGGCCGGAGGG - Intergenic
924657337 1:245984899-245984921 CAGAGCAAGGAGAAGTCGGATGG - Intronic
1063145697 10:3293602-3293624 CAGAGAACCGTGACTCCGGAGGG + Intergenic
1063609912 10:7553502-7553524 CAGAGAACCCAGGACCCAGAGGG - Intergenic
1069729048 10:70599364-70599386 CAGAGCACTGAGGTCCCTGAGGG - Intronic
1070594754 10:77824721-77824743 CAGAACACCGAGGACCCGGAGGG + Intronic
1071568118 10:86681843-86681865 CCGAGCACCGAGGACCCAGGTGG - Intronic
1073207295 10:101775913-101775935 CGGGGCACCGAGAGCCCGGCGGG + Exonic
1077409183 11:2395550-2395572 CAGGGCCCCGGGAACCCGGCGGG + Intronic
1079437026 11:20466433-20466455 CAGAGGACCAGGAACCAGGATGG - Intronic
1084511392 11:69606593-69606615 CAGAGCACTGTGAACGCAGAAGG + Intergenic
1088696258 11:112368591-112368613 CAGAGCACAGAGAATCAGGGTGG + Intergenic
1095219276 12:39589477-39589499 GAGAACAGCGAGAACCCGGGAGG - Intronic
1101080060 12:101172877-101172899 CAGACCACCTTGCACCCGGATGG - Intronic
1102717634 12:114987940-114987962 GAGAACAGCGTGAACCCGGAAGG - Intergenic
1104372145 12:128232905-128232927 CACAGCACCCAGAACCCTGAAGG + Intergenic
1104876420 12:132038161-132038183 CTGAGCACCCAGAACCCTGGGGG - Intronic
1106417156 13:29555527-29555549 GAGAGCACCGAGAACCATGAAGG + Intronic
1113168014 13:107465449-107465471 CAGAGCACAGAGACCCAGGCAGG - Intronic
1115662969 14:35515526-35515548 CAGAGTGGCGTGAACCCGGAAGG - Intergenic
1115813589 14:37137088-37137110 CAGAGTGGCGTGAACCCGGAAGG - Intronic
1116021943 14:39471870-39471892 CAGAGCACAGAGGATCTGGAGGG - Intergenic
1118296831 14:64577813-64577835 GAGAACAGCGTGAACCCGGAAGG - Intronic
1119076245 14:71642345-71642367 CAGAGCACAGAGAATCAGGGAGG + Intronic
1121895667 14:97645007-97645029 GAGAACAGCGTGAACCCGGAAGG - Intergenic
1124480210 15:30072990-30073012 CAGAGCAGCAAGACCCAGGAGGG - Intergenic
1130560639 15:84955645-84955667 CAGAGCACAGAGCCCCAGGAGGG + Intergenic
1133164889 16:3939294-3939316 CAGAGCAGGGAGACCCCGGCTGG - Intergenic
1136010334 16:27359405-27359427 CAGGCCAATGAGAACCCGGAAGG - Intronic
1136859690 16:33691003-33691025 TAGAGCACAGAAAACCAGGATGG + Intergenic
1137732069 16:50696734-50696756 CAGAGCAGAGAGAATCCTGAGGG - Intronic
1141674625 16:85511174-85511196 CAGAGAAGCAAGAACCTGGAAGG + Intergenic
1203121196 16_KI270728v1_random:1539182-1539204 TAGAGCACAGAAAACCAGGATGG + Intergenic
1145155953 17:20545361-20545383 CAGAGCAGCCAGAACACGGTGGG + Intergenic
1150248020 17:63690583-63690605 AAGAGCACCAAGCACCTGGAGGG + Intronic
1151282953 17:73090086-73090108 CAGAGCACCGGGAACTGGCAGGG - Intronic
1152896469 17:82914217-82914239 CAGAGCACCGAGAACCCGGATGG - Intronic
1155074145 18:22340564-22340586 CAGAGCTCCGAGAACAGGGCAGG + Intergenic
1157557088 18:48619871-48619893 CAGAGCACCCAGAATCTGGCAGG + Intronic
1158009851 18:52716191-52716213 CAGAGCAGCGAGATCCCAGGGGG + Intronic
1160499329 18:79394497-79394519 CAGAGCACCGGGCGCCGGGAGGG - Intergenic
1163682551 19:18691635-18691657 CAGAGCCCCCAGAAGCTGGAAGG + Intronic
926035493 2:9632219-9632241 CATAGCAGCGTGAACCCAGAGGG - Intergenic
930272617 2:49274466-49274488 CAAAGGACCAAGAACCAGGAGGG - Intergenic
932151899 2:69380708-69380730 CAGAGCACAGTGGACCCAGAGGG - Intronic
932612484 2:73210165-73210187 CAGATCACCCAGGACCTGGAAGG - Intronic
938260505 2:129892240-129892262 CAGGGCCCCGAGCACCCTGAGGG - Intergenic
942142675 2:172993707-172993729 CAGAACCCCAAGAACCCAGAGGG + Intronic
946359932 2:219213169-219213191 CAGAGCACTGAGAAGCAGGAAGG + Intronic
946704676 2:222446429-222446451 CCGAGTACCCAGAACCCTGAGGG + Intronic
1173827898 20:46058852-46058874 CAGAGCACGGAGAAGGCGGCTGG - Intronic
1173969871 20:47144264-47144286 GAGAGTAGCGTGAACCCGGAAGG + Intronic
1175213365 20:57375673-57375695 CAGAGCACAGGGAACCAAGAGGG - Intronic
1175408633 20:58751775-58751797 CAGGGCACCGAGATCCAGGAAGG + Intergenic
1177809054 21:25905231-25905253 CCGAGCATCGAGGACCAGGAGGG + Intronic
1179615485 21:42580592-42580614 CAGAGAACCGAAGACCCGGCCGG + Exonic
1181358160 22:22314316-22314338 CAGAGCACAGAAAACCAGGACGG - Intergenic
1181520545 22:23446920-23446942 CAGAGCTCTGAGAACCAGGGTGG + Intergenic
1184803890 22:46779716-46779738 CGGAGCACTGAGAACCCAGTAGG - Intronic
957312734 3:78541381-78541403 CAGAACACAGAGAGCCTGGAGGG - Intergenic
957994405 3:87671065-87671087 CAGAGCTCCTAGACCCCAGAGGG + Intergenic
963226349 3:142866364-142866386 CAGAGACCTGAGAACCAGGAGGG - Intronic
969090761 4:4692378-4692400 CAGAGGCCCAAGAACCAGGAGGG + Intergenic
969606358 4:8204131-8204153 CAGGGCATGGAGAACCGGGACGG - Intronic
973323068 4:48830063-48830085 CAGTGCACAGAGAACACTGAGGG + Intronic
974338779 4:60586940-60586962 GAGAACGCCGTGAACCCGGAAGG - Intergenic
975977097 4:80111942-80111964 CAGAGCACAGAGGACCTGTAAGG + Intronic
979357682 4:119724645-119724667 CAGAGGATCGAGAGCCAGGAGGG + Intergenic
988731574 5:33977762-33977784 CAGAGCACAGAGAATGTGGAAGG + Intronic
989271110 5:39533939-39533961 CACAGCACAGAGAGCCCGGATGG + Intergenic
991064223 5:62408613-62408635 CAGAACGGCGTGAACCCGGAAGG + Intronic
992989811 5:82273046-82273068 CTGAACACCGGGAACCGGGAAGG - Intronic
997415447 5:133724376-133724398 CAGAGCACAGAAACCCAGGATGG - Intergenic
1003026236 6:2558170-2558192 CAGAGCACCGAGGACAGGGCGGG - Intergenic
1003134649 6:3425030-3425052 CAGAGCACAGTGAACACGGGTGG - Intronic
1003302444 6:4896404-4896426 CAGAGCACCGACTACACGGCAGG - Intronic
1008688905 6:53956063-53956085 CAGAGAACACAGAACCCAGAGGG - Intronic
1009050579 6:58271013-58271035 GTGAGCACCGAGAAGCCAGATGG + Intergenic
1009239840 6:61171371-61171393 GTGAGCACCGAGAAGCCAGATGG - Intergenic
1011434126 6:87319476-87319498 CAGATCACTGAGAACCCTAAGGG + Intronic
1017828683 6:158103648-158103670 CAGAACACGGAGAGCCCAGAAGG - Intergenic
1018768088 6:166949841-166949863 CAGAACACTGAGAACCCGACAGG + Intronic
1019590698 7:1829322-1829344 CAGAGCTCTGAGAACCAGGGTGG - Intronic
1024084624 7:45883118-45883140 CAGAGCACCAAGAGCAGGGAGGG - Intergenic
1032068345 7:128789631-128789653 CAGAGCCCGGACAACCCGGAGGG + Intergenic
1035743233 8:1944451-1944473 CAGAGCCCAGTGAACCCGGCGGG - Intronic
1038133263 8:24758269-24758291 CAGAGCACAGAAACCCAGGATGG + Intergenic
1039837065 8:41265089-41265111 CAGTGCCCCGGGAACCCGGTGGG - Exonic
1043296643 8:78671737-78671759 CAGAGAACTGAGAACCTGAAAGG - Intronic
1048871284 8:138801481-138801503 CTGAGCACTGAGAACACAGAAGG + Intronic
1049813159 8:144585344-144585366 CAGCTCACCGAGAACCTGGAGGG + Intronic
1049813173 8:144585389-144585411 CGGCTCACCGAGAACCTGGAGGG + Intronic
1049813188 8:144585434-144585456 CGGCTCACCGAGAACCTGGAGGG + Intronic
1055062992 9:72090202-72090224 CAGAGGCCTGAGAACCCAGAGGG - Intergenic
1055425234 9:76188578-76188600 CAGAGCACCGGGATCCCTGCAGG - Exonic
1056623948 9:88238289-88238311 CTGAGCCCCGAGAACTTGGATGG + Intergenic
1056685892 9:88759056-88759078 CAGAGTACCAATAACCCAGAGGG + Intergenic
1061080249 9:128365451-128365473 GAGAGCACCGAGACTCCGAATGG - Intergenic
1186223017 X:7369589-7369611 CAGAGGACAGAGCACCCAGAGGG + Intergenic