ID: 1152896520

View in Genome Browser
Species Human (GRCh38)
Location 17:82914422-82914444
Sequence GTGGAGAAGGGCATCTTTAT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 147
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 133}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152896509_1152896520 18 Left 1152896509 17:82914381-82914403 CCTCAGGGTTCACGGCAGGGTGT 0: 1
1: 0
2: 1
3: 8
4: 147
Right 1152896520 17:82914422-82914444 GTGGAGAAGGGCATCTTTATGGG 0: 1
1: 0
2: 0
3: 13
4: 133
1152896508_1152896520 19 Left 1152896508 17:82914380-82914402 CCCTCAGGGTTCACGGCAGGGTG 0: 1
1: 0
2: 1
3: 9
4: 125
Right 1152896520 17:82914422-82914444 GTGGAGAAGGGCATCTTTATGGG 0: 1
1: 0
2: 0
3: 13
4: 133

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152896520 Original CRISPR GTGGAGAAGGGCATCTTTAT GGG Intronic
904197456 1:28796445-28796467 GAGGTAAAGGGCATCTTTCTGGG + Intergenic
905757424 1:40522979-40523001 GGGGAGATGGGCAGCTTTCTGGG - Intergenic
906287467 1:44596733-44596755 GGAGAGAAGGGCCTCTTTCTAGG + Intronic
911417619 1:97595132-97595154 TTGGAAGATGGCATCTTTATTGG + Exonic
913190312 1:116407859-116407881 GTGGAGAGGGGCAGCCATATGGG - Intronic
913286737 1:117233505-117233527 TTGGAGAAGGGGCTCTTTTTAGG - Intergenic
913591423 1:120331373-120331395 TTGGAGCAGTCCATCTTTATGGG - Intergenic
913651937 1:120923729-120923751 TTGGAGCAGTCCATCTTTATGGG + Intergenic
914169166 1:145205342-145205364 TTGGAGCAGTCCATCTTTATGGG - Intergenic
914524287 1:148449300-148449322 TTGGAGCAGTCCATCTTTATGGG - Intergenic
914599389 1:149186574-149186596 TTGGAGCAGTCCATCTTTATGGG + Intergenic
914642118 1:149617836-149617858 TTGGAGCAGTCCATCTTTATGGG + Intergenic
914836769 1:151213239-151213261 GTGGAGCAGGGCTACCTTATAGG + Intronic
915478073 1:156165687-156165709 GTGGAGCAGGGCTACCTTATAGG + Intronic
916901028 1:169224067-169224089 GATGAGAAGAGCATCTTCATGGG - Intronic
917680536 1:177361530-177361552 GTAGAGAAGGGCTTTTGTATAGG + Intergenic
919952660 1:202379561-202379583 GTTGAGACTGTCATCTTTATGGG + Intronic
920142344 1:203826262-203826284 GTGGAGCAGGGCCACTCTATAGG + Intronic
921154683 1:212430038-212430060 TAGGAGAGGGGCAGCTTTATAGG + Intergenic
1069799352 10:71072599-71072621 GTGGAGATGAGCATCTTTCTTGG + Intergenic
1075382358 10:122029712-122029734 GTTGAGAAGGGCATAGCTATCGG + Intronic
1079379801 11:19927829-19927851 GTGGAGAAGTGGCTGTTTATTGG + Intronic
1081275087 11:41138455-41138477 CTGGAGAAGGACATTTTGATAGG + Intronic
1083092825 11:60218612-60218634 GAGGAGAAGGCCATCACTATCGG - Intronic
1084039454 11:66532910-66532932 ATGTAGAAGGGCATCTATATGGG - Exonic
1091997885 12:5009327-5009349 GTGGAGAAAGGCAGCATCATGGG + Intergenic
1095344490 12:41133623-41133645 ATGGAAAAGGACATCTTTAAGGG - Intergenic
1099297019 12:80841074-80841096 GTGGAGAAGAGAATATTTAGGGG - Intronic
1101922043 12:108940980-108941002 GTGGACAAGGGTATCTCTGTGGG + Intronic
1103740628 12:123088890-123088912 GTGGAGAAGGGCATTTCTGGAGG - Intronic
1105484856 13:20818409-20818431 GGGAAGAAGAGCATCTTCATAGG - Intronic
1106313302 13:28572467-28572489 GAGGTGAAGGGCATTGTTATAGG - Intergenic
1108959327 13:56203859-56203881 GTGGAGAAGGGAAACCTTCTGGG - Intergenic
1118680789 14:68239482-68239504 GTGGAGAAGGACAGCTTTTTGGG - Intronic
1119222591 14:72921069-72921091 GGGAAGAAGGACATCTGTATTGG + Intergenic
1122738023 14:103855054-103855076 GTGGGGAAGGGCTTCTATCTGGG + Intergenic
1125421657 15:39510499-39510521 ATGGAGAAGGGCTTCTCTAGAGG + Intergenic
1127559531 15:60122108-60122130 GTGAAGAAGGGCATATTCAAAGG + Intergenic
1131342389 15:91614515-91614537 CTGCAGAAGGGCAACTTTGTAGG + Intergenic
1137332108 16:47508049-47508071 GTGGAGAAGGGAGACTTTCTAGG - Intronic
1137352360 16:47724675-47724697 TTGGGGAAGGGCGTCTTTCTGGG - Intergenic
1137447169 16:48539011-48539033 TGGGAGAAGGGCATCTCTAGCGG + Exonic
1140658316 16:77163093-77163115 TTCGAGAAGGACATCTTTAGGGG - Intergenic
1140839123 16:78822536-78822558 GTGGGGATGGGAATTTTTATTGG - Intronic
1150160968 17:62897626-62897648 GTTCAGATGGCCATCTTTATTGG - Intergenic
1152896520 17:82914422-82914444 GTGGAGAAGGGCATCTTTATGGG + Intronic
1157421313 18:47550000-47550022 GGGGAGAAGGGCATCTTCTCTGG - Intergenic
1160020865 18:75179901-75179923 TTGGAGAATGGCATCTGTGTTGG + Intergenic
1163209331 19:15829063-15829085 TAGGAGAGGGGCAGCTTTATAGG - Intergenic
1163210390 19:15836034-15836056 TAGGAGAGGGGCAGCTTTATAGG - Intergenic
1167229030 19:48270049-48270071 TAGGAGAGGGGCAGCTTTATAGG - Intronic
1167575517 19:50315728-50315750 GGGGAGAGGGACATCTTTAAAGG + Exonic
925454960 2:4008145-4008167 GTGGAGGAGGGAATCTATCTTGG + Intergenic
926602701 2:14863335-14863357 TAGGAGAGGGGCAGCTTTATAGG + Intergenic
927638102 2:24830643-24830665 GTGGAGAAGGGCTTCTGTTTGGG - Intronic
933394777 2:81717294-81717316 TGGGAGAAGGGCATAATTATTGG + Intergenic
940308250 2:152249464-152249486 TTGGATAAGGGCATCTTGAAGGG - Intergenic
940564488 2:155343523-155343545 GTGGTGAAGCGTTTCTTTATTGG - Intergenic
945936810 2:215910844-215910866 GTGGAGAAAGACATGGTTATGGG + Intergenic
1170282681 20:14668421-14668443 CAGGAGAAGGGCATCTTTGAAGG + Intronic
1171037902 20:21731077-21731099 GATGTGAAGGGCATCTTTCTGGG - Intergenic
1172088249 20:32406734-32406756 GTTGAGAAGGGCATGTATATGGG - Intronic
1173785442 20:45789771-45789793 GTGGAGATGATCATCTCTATAGG - Intronic
1175552910 20:59828611-59828633 GAGGAGAAGGACATCTTTGCCGG + Intronic
1175901781 20:62362791-62362813 GTGGAGAGGGGCATCTGCCTTGG + Intronic
1178110817 21:29368730-29368752 GTGCAGAATTGCATCTTTTTAGG + Intronic
1178240423 21:30893544-30893566 GTGGAGCAGGGCTACCTTATAGG - Intergenic
1179330839 21:40399371-40399393 GTGGAAAAGGGTTTCTATATTGG + Intronic
1182756490 22:32683828-32683850 GTAGAGAAGGGTATTGTTATGGG - Intronic
1183637850 22:39075828-39075850 TAGGAGAGGGGCAGCTTTATAGG + Intronic
949684298 3:6550107-6550129 GAGGTGAAGTGCTTCTTTATAGG - Intergenic
949878048 3:8639623-8639645 GTGGAGAAAGGCATTATTAATGG + Intronic
950094060 3:10317995-10318017 GTGGACATGGGCATTTTTGTGGG - Intronic
951064056 3:18243656-18243678 CTGGAGAAGGGGATCTATGTTGG - Intronic
951315554 3:21185818-21185840 CAGGAGAGGGGCAGCTTTATAGG + Intergenic
953437058 3:42885981-42886003 GTGGAGAAAGGCATCTAAAGAGG + Intronic
955056366 3:55459307-55459329 TTGCAGAGGGGCATCTATATAGG - Intergenic
955836499 3:63061277-63061299 TTGCAGAAGGGCATCATTTTGGG - Intergenic
955863714 3:63359530-63359552 ATGGAAAAGGGCATCTCTCTGGG - Intronic
956487928 3:69740873-69740895 GTGGAGAAGGGCAACTGAACGGG + Intronic
957206267 3:77202934-77202956 GTGGATAAGGGCATCTCTGCTGG - Intronic
960672648 3:120167708-120167730 TTGGAGAGGGGCATCTTTTGGGG + Exonic
962108800 3:132420345-132420367 GGGGAGAAGGGTATCTCTGTTGG + Intronic
964300768 3:155282892-155282914 TAGGAGAGGGGCAGCTTTATAGG + Intergenic
965931744 3:174051968-174051990 GAGGAGAGGGGGTTCTTTATTGG - Intronic
967142300 3:186571062-186571084 GTGGAGAGGGGCATCGCTGTGGG + Intronic
967886992 3:194340239-194340261 GGGGAAAGGGGCTTCTTTATAGG + Exonic
970483187 4:16498428-16498450 GTGGAGAATGGCATTTTAAGAGG + Intergenic
970535709 4:17027928-17027950 TTGGAGATGGACTTCTTTATGGG + Intergenic
970991091 4:22214204-22214226 TTGGAGAAGTGAATTTTTATAGG + Intergenic
971221023 4:24706100-24706122 ATGGAGAAGGGCCTCTTCCTGGG - Intergenic
973041157 4:45471893-45471915 GTGGGGAAGTGCATGTTGATTGG - Intergenic
975817916 4:78238742-78238764 GTGGGGAAGGGCATTTTTCATGG - Intronic
976055968 4:81067477-81067499 GTAGAGAAGGGCATCCTTAAAGG + Intergenic
976165118 4:82246397-82246419 GTGGAGAAGTGCATCCTTCCTGG - Intergenic
976422200 4:84858798-84858820 GTGGAGAAAGGCATCGTCAGGGG + Intronic
977214692 4:94266858-94266880 GTGAAAAATGACATCTTTATAGG + Intronic
978730147 4:112016355-112016377 GTTGACAAGATCATCTTTATGGG - Intergenic
982692528 4:158565046-158565068 GGTGAGAAGGGCATCCTTAGAGG + Intronic
986493076 5:8313488-8313510 ATGGAGTTGGGCAACTTTATAGG - Intergenic
989159274 5:38374713-38374735 GTCAAGAAGGGGATCTTTATGGG + Intronic
991059250 5:62355458-62355480 TTCGAGAAGGACATCTCTATAGG - Intronic
996779597 5:127171394-127171416 GTGGAGGACGGCATCTCGATAGG - Intergenic
998420124 5:141977132-141977154 TTGGAGAATGGCTTCTTCATAGG + Intronic
1000542051 5:162552312-162552334 GTGGATATGGACATCTTTGTGGG - Intergenic
1001107654 5:168868923-168868945 TTGGAGAATGGGATCTTTCTGGG + Intronic
1001451345 5:171827030-171827052 GGGGAGGAGGGCATCCATATAGG + Intergenic
1003135073 6:3428700-3428722 GTTGTGAAGGGCTTCCTTATTGG - Intronic
1004409859 6:15370855-15370877 GTTGAGAAAGGCAGCTTAATTGG + Intronic
1005626220 6:27665052-27665074 GTGGAGGAGCTCATGTTTATGGG - Intergenic
1006202898 6:32312636-32312658 GTGGAGAAGAGCAGATTTATAGG - Intronic
1006203549 6:32319117-32319139 GCGGAGAAGAGCAGATTTATAGG - Intronic
1007683494 6:43650439-43650461 GTGGTGAAGGGCCGCTTCATGGG + Exonic
1007889214 6:45270900-45270922 ATGGAGATGGGGAACTTTATGGG + Intronic
1010644247 6:78367828-78367850 ATGGAGAAGGTCATCTGGATTGG + Intergenic
1010767354 6:79791294-79791316 GATGAGGAGGGCATCTTTGTGGG - Intergenic
1011716523 6:90111321-90111343 GTGGAGAAGGGCTTCTACAGAGG - Intronic
1017719300 6:157233822-157233844 GTGGAGAAGGGAAGCTCTTTGGG - Intergenic
1018202427 6:161407945-161407967 TAGGAGAGGGGCAGCTTTATAGG - Intronic
1018991509 6:168677283-168677305 TAGGAGAGGGGCAGCTTTATAGG + Intergenic
1021137250 7:16980403-16980425 AGGGAGAAAGGTATCTTTATCGG - Intergenic
1022041164 7:26582789-26582811 GTAGAGAAGGGCTCTTTTATGGG - Intergenic
1023626065 7:42116185-42116207 GTGGAGAAGAGCAGTTTTATGGG + Intronic
1023689122 7:42768052-42768074 CTGGAGAAGGGAATCCTTAAGGG + Intergenic
1028820071 7:95198772-95198794 GTGAATAATGTCATCTTTATTGG + Intronic
1038678723 8:29647151-29647173 CTGGAGAGGGGGATCTTCATGGG + Intergenic
1043060345 8:75492531-75492553 GTGGTGAAGGCCATCATTATTGG - Intronic
1043432428 8:80207841-80207863 GTGTAGAAGGGCAGGTTTCTGGG + Intronic
1045316869 8:101051141-101051163 TTGGAGAAGGGGAGCTTGATTGG + Intergenic
1049464075 8:142743253-142743275 GTGGAGAGGGGCACCTTAGTGGG - Intergenic
1050246972 9:3700777-3700799 GAGGAAAAGGGCATCTTAGTTGG - Intergenic
1055002022 9:71462183-71462205 TTGGACAAGGTTATCTTTATTGG - Intergenic
1055633397 9:78247905-78247927 GTGGAGAAGAGCAGCTTTGGGGG + Intronic
1056233746 9:84571627-84571649 GTGGAGAAGGGAATATTCATAGG + Intergenic
1060209501 9:121701040-121701062 GCGGAGAAGGGCATGTTCCTGGG - Intronic
1185792143 X:2935243-2935265 CTGGAGAATGGCATCTTCATAGG + Intronic
1186511958 X:10136107-10136129 GTAAAGAATGTCATCTTTATGGG - Intronic
1186628220 X:11318049-11318071 ATGGAGAAGGGAATATTTAAGGG - Intronic
1186868133 X:13741684-13741706 TAGGAGAGGGGCAGCTTTATAGG + Intronic
1187191540 X:17040067-17040089 GTGGTTAAAGGCATCTTTGTGGG + Intronic
1187231664 X:17429438-17429460 TTGAAGAAGGGGAACTTTATTGG + Intronic
1188411538 X:29878098-29878120 GTGGACATGGGCCTCTTTCTTGG + Intronic
1193741509 X:85222837-85222859 GTGGAGAAGAACCTATTTATGGG - Intergenic
1196870399 X:120108181-120108203 ATGGAGAAGAGCCTCTTTTTGGG + Intergenic
1199241419 X:145552188-145552210 GTTGAGAAGGGCTTGTTGATTGG - Intergenic
1201281542 Y:12347061-12347083 CTGGTGAATGGCATCTTCATAGG - Intergenic
1201568758 Y:15392449-15392471 TTGGAGAATAGCATCTTTATAGG - Intergenic