ID: 1152899303

View in Genome Browser
Species Human (GRCh38)
Location 17:82930853-82930875
Sequence TTCTAGCCTCCACATGAGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 137
Summary {0: 1, 1: 0, 2: 2, 3: 13, 4: 121}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152899299_1152899303 -10 Left 1152899299 17:82930840-82930862 CCTGCGCCTCCTCTTCTAGCCTC 0: 1
1: 0
2: 3
3: 25
4: 351
Right 1152899303 17:82930853-82930875 TTCTAGCCTCCACATGAGGCAGG 0: 1
1: 0
2: 2
3: 13
4: 121
1152899294_1152899303 11 Left 1152899294 17:82930819-82930841 CCGGGCGGCCAGGCCTCAGCCCC 0: 1
1: 0
2: 11
3: 170
4: 686
Right 1152899303 17:82930853-82930875 TTCTAGCCTCCACATGAGGCAGG 0: 1
1: 0
2: 2
3: 13
4: 121
1152899296_1152899303 -2 Left 1152899296 17:82930832-82930854 CCTCAGCCCCTGCGCCTCCTCTT 0: 1
1: 0
2: 7
3: 97
4: 818
Right 1152899303 17:82930853-82930875 TTCTAGCCTCCACATGAGGCAGG 0: 1
1: 0
2: 2
3: 13
4: 121
1152899290_1152899303 29 Left 1152899290 17:82930801-82930823 CCTGCAGCATATGGTTCTCCGGG 0: 1
1: 0
2: 0
3: 4
4: 80
Right 1152899303 17:82930853-82930875 TTCTAGCCTCCACATGAGGCAGG 0: 1
1: 0
2: 2
3: 13
4: 121
1152899297_1152899303 -8 Left 1152899297 17:82930838-82930860 CCCCTGCGCCTCCTCTTCTAGCC 0: 1
1: 0
2: 1
3: 26
4: 264
Right 1152899303 17:82930853-82930875 TTCTAGCCTCCACATGAGGCAGG 0: 1
1: 0
2: 2
3: 13
4: 121
1152899298_1152899303 -9 Left 1152899298 17:82930839-82930861 CCCTGCGCCTCCTCTTCTAGCCT 0: 1
1: 0
2: 0
3: 24
4: 257
Right 1152899303 17:82930853-82930875 TTCTAGCCTCCACATGAGGCAGG 0: 1
1: 0
2: 2
3: 13
4: 121
1152899295_1152899303 3 Left 1152899295 17:82930827-82930849 CCAGGCCTCAGCCCCTGCGCCTC 0: 1
1: 1
2: 7
3: 84
4: 890
Right 1152899303 17:82930853-82930875 TTCTAGCCTCCACATGAGGCAGG 0: 1
1: 0
2: 2
3: 13
4: 121

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152899303 Original CRISPR TTCTAGCCTCCACATGAGGC AGG Intronic
900640478 1:3685896-3685918 TTCTAGCCCCACCACGAGGCTGG + Intronic
904953370 1:34262457-34262479 TTCAAGCCACAACATGAGGGTGG + Intergenic
905286841 1:36886195-36886217 TCCTTCCCTCCACATGAGGCCGG - Intronic
907275683 1:53315475-53315497 CTCCATCCTCCAGATGAGGCAGG + Intronic
909527199 1:76638771-76638793 TTCTAGTTTCCACATGATCCTGG - Intergenic
910037818 1:82809351-82809373 TTTTAGCCTCTTCATGGGGCAGG - Intergenic
914243805 1:145871522-145871544 TTCTCGCCTCCACTTCAGGGTGG - Intronic
917400040 1:174637669-174637691 TTCGTGCCTCCTCATGAGGGAGG + Intronic
920396345 1:205648788-205648810 TTCTGGCCTGCATTTGAGGCTGG - Intergenic
1064347899 10:14549137-14549159 TTCTAGCCTCCACAAGTGTGAGG + Intronic
1066186671 10:33016201-33016223 CTCTAGCCTTCTCTTGAGGCAGG + Intergenic
1067660139 10:48230869-48230891 ATGTAGCCTGCACATCAGGCAGG - Intronic
1067832130 10:49616393-49616415 CTCTGGCCTCCTCATGGGGCTGG + Intronic
1069727855 10:70592808-70592830 TTCTGGCCTCCTGATGGGGCAGG + Intergenic
1070556954 10:77535813-77535835 TTTTAGCTTCCACATGAGTAAGG - Intronic
1073930288 10:108567016-108567038 TTTTAGCCTCCTCATTCGGCGGG - Intergenic
1075969445 10:126640081-126640103 TTATGGCCTCCACAGGAAGCAGG + Intronic
1081646045 11:44791450-44791472 TTCTAGCCTTCACATGTCGGGGG - Intronic
1082069673 11:47928849-47928871 TTATAACCTCCTCATGAGGTGGG - Intergenic
1082790692 11:57344969-57344991 GTCCAGCCTCCACCTGAGGAAGG + Intronic
1083451244 11:62746838-62746860 ATCAAACCTCCACTTGAGGCCGG - Intergenic
1088946502 11:114518428-114518450 TTCCAGTCTTCACCTGAGGCTGG - Intergenic
1092595482 12:9999684-9999706 TTGAAGGATCCACATGAGGCAGG + Intronic
1097564180 12:61247934-61247956 TTTCAGCCTCCAGATGAGGAGGG + Intergenic
1098309786 12:69137023-69137045 TTCTAGATTCCACAGGAGGCAGG + Intergenic
1103229166 12:119313715-119313737 TTCTAGTCTCCTAAAGAGGCTGG + Intergenic
1110268144 13:73563081-73563103 TTCACTCCTCTACATGAGGCTGG + Intergenic
1110430477 13:75417284-75417306 CTTCAGCCTGCACATGAGGCTGG - Intronic
1117065742 14:52011931-52011953 TTATAGCAACCATATGAGGCAGG - Intronic
1119578058 14:75746072-75746094 TTCAATCCTCCACATGACCCTGG + Intronic
1121429323 14:93875748-93875770 TTCTAACCTACAAATGAGGCAGG + Intergenic
1124699276 15:31897406-31897428 TTCTAGGCCCCACAGGAGGCAGG + Intergenic
1124882646 15:33656625-33656647 TTAGAGCCTCCAGATGAGCCTGG - Intronic
1127390568 15:58501974-58501996 TTCTAGCCTCCCCAGGAGAGTGG - Intronic
1128479325 15:68023704-68023726 TTTCAGCCTCCAAATGAGGAGGG + Intergenic
1128720343 15:69943284-69943306 TTCCAGCCTGCAAATGAGGCGGG - Intergenic
1129669381 15:77598676-77598698 TTTTAGCTTCCACTGGAGGCTGG + Intergenic
1129705276 15:77790747-77790769 CTCTAGGGTCCACATGGGGCAGG - Intronic
1134599466 16:15522094-15522116 CTTTGGCCTCCACATGGGGCAGG + Intronic
1141190173 16:81818998-81819020 TTCTAGGCCCACCATGAGGCAGG + Intronic
1141884439 16:86882086-86882108 TTCGAGCTTCCACATGGGGCTGG - Intergenic
1143781169 17:9230464-9230486 ATCTGGCCTCCATATGGGGCTGG - Intronic
1143973372 17:10812250-10812272 TTCTGCCCCCCTCATGAGGCTGG + Intergenic
1151198242 17:72447034-72447056 TTTTGGCCTCCAGATGTGGCTGG + Intergenic
1152899303 17:82930853-82930875 TTCTAGCCTCCACATGAGGCAGG + Intronic
1154123647 18:11671371-11671393 TTGTGGCCTCCAAGTGAGGCAGG + Intergenic
1155548720 18:26941947-26941969 TTCTCCCCCCCACATCAGGCAGG - Intronic
1156580396 18:38368401-38368423 TTCTAGCCAGCACAGGTGGCTGG + Intergenic
1157751420 18:50182072-50182094 TTACAGCCAGCACATGAGGCTGG - Intronic
1160081162 18:75728542-75728564 CTCCAGCCTGAACATGAGGCAGG - Intergenic
1165271622 19:34712529-34712551 TCCTAGCCATCACATGAGGCTGG + Intergenic
1166371763 19:42305719-42305741 TTCTAGCAACCAAATGAGGAAGG + Intronic
1168471423 19:56643482-56643504 TTCCAGCCTCCTCGTGAGGAGGG + Intronic
926144221 2:10386928-10386950 CTCTGGCCTCCACATGAGGCAGG + Intronic
926196769 2:10768820-10768842 TGCCAGCCTCCACATCTGGCGGG + Intronic
938140044 2:128787694-128787716 TGCTAACCTCCTCCTGAGGCGGG - Intergenic
938969846 2:136421979-136422001 TTCTAGGCTCCACCATAGGCAGG + Intergenic
939657594 2:144847400-144847422 TTCTAGCCTCAGCAATAGGCAGG + Intergenic
942460835 2:176167493-176167515 TTCTAGCCTCAAAATGAGTCTGG + Intronic
945712785 2:213320631-213320653 TTTTAGCTTCCACATGAGTAAGG + Intronic
947619321 2:231578548-231578570 TTCCAGCATCTTCATGAGGCAGG - Intergenic
948586653 2:239024135-239024157 TTCCTGCCACCACATGAAGCAGG - Intergenic
1169041698 20:2500786-2500808 TTCTAGCCTCCATATCTGGGTGG - Intronic
1170421878 20:16201230-16201252 TTCTTGCCCCCACATGTGCCTGG + Intergenic
1170835974 20:19885012-19885034 TTCTAGCCGTTAAATGAGGCCGG - Intergenic
1172293670 20:33793114-33793136 TTCCCGCCTCCTCATGAGCCCGG - Intergenic
1172824301 20:37767483-37767505 TTCTTGCTTCCACCTGATGCAGG + Intronic
1174302596 20:49593225-49593247 GACTAACCTCCACAGGAGGCTGG - Intergenic
1179277679 21:39907215-39907237 TTCTCCCCTCCACATGAGGCAGG + Intronic
1179300014 21:40099776-40099798 TTCCAGGCTCCAAAAGAGGCTGG + Intronic
1183227201 22:36558718-36558740 TTCAAACCTCCATCTGAGGCAGG + Intergenic
1183249624 22:36720901-36720923 TTCTCTCCTCCTCAGGAGGCTGG + Intergenic
1183651575 22:39157779-39157801 TTCCAGCCTTCACATGGAGCAGG + Intergenic
1184694083 22:46130227-46130249 TGCCAGCCTCCCGATGAGGCCGG - Intergenic
949811491 3:8011615-8011637 AGCAAACCTCCACATGAGGCTGG - Intergenic
950192197 3:10985103-10985125 TTCTTGCCTCTCCATGGGGCTGG - Intergenic
953202763 3:40792209-40792231 TTCCTGCCTCCACATGAACCTGG + Intergenic
954760699 3:52871493-52871515 ATCTAGCCTCCCCCTGTGGCAGG + Intronic
962515422 3:136145524-136145546 TTCTAGGCTCCATAGGAGCCCGG - Exonic
965779236 3:172266634-172266656 TGCCAGCATCCACCTGAGGCTGG - Intronic
969112210 4:4851189-4851211 TTCTAGCCTCTGCATGAGGTGGG - Intergenic
971233174 4:24817319-24817341 TACAAGCAGCCACATGAGGCTGG + Intronic
973752141 4:54032024-54032046 TTCTAGCCACCACATGTTACAGG + Intronic
974012808 4:56623089-56623111 TTCTAGCCTGCCCAGGATGCAGG + Intergenic
974512389 4:62860669-62860691 TTATAGCCTACACATGAAGTTGG - Intergenic
977338580 4:95729178-95729200 TTCAGGCCTCAACATGGGGCAGG - Intergenic
977926141 4:102702874-102702896 TTCTAGCCTCAACAGGGGGAAGG + Intronic
979540930 4:121881129-121881151 TTGTAGTCTCCCCATGAGTCGGG - Intronic
983779057 4:171645039-171645061 TTCCAGCCCCCACAGGAGGAAGG - Intergenic
984053223 4:174893195-174893217 TTCTAGCCTCTCCAATAGGCAGG + Intronic
986098345 5:4582318-4582340 TCCCAGCCTCCACAGAAGGCAGG + Intergenic
988754412 5:34231642-34231664 TGGTGGCTTCCACATGAGGCTGG + Intergenic
991626178 5:68603307-68603329 ATCAAGCCTCCTCTTGAGGCAGG - Intergenic
991742621 5:69697335-69697357 TGGTGGCTTCCACATGAGGCTGG + Intergenic
991755073 5:69857869-69857891 TGGTGGCTTCCACATGAGGCTGG - Intergenic
991794194 5:70277073-70277095 TGGTGGCTTCCACATGAGGCTGG + Intergenic
991822011 5:70572648-70572670 TGGTGGCTTCCACATGAGGCTGG + Intergenic
991834400 5:70733017-70733039 TGGTGGCTTCCACATGAGGCTGG - Intergenic
991886572 5:71276615-71276637 TGGTGGCTTCCACATGAGGCTGG + Intergenic
995390795 5:111638663-111638685 TTCTAGAATCCCCAGGAGGCAGG - Intergenic
999286521 5:150397465-150397487 TTCTAGACTCCGCATGCAGCAGG + Intronic
1001751718 5:174136507-174136529 TTCTAGCCTCCATGTTAGGGTGG + Intronic
1003441664 6:6148417-6148439 TTCTAGACACCACATCTGGCAGG + Intronic
1003456393 6:6286545-6286567 TTCTTGCCTCCTCATAAGGCAGG - Intronic
1004332114 6:14731275-14731297 TTCTAGCCTCCAGAAGAGTGAGG - Intergenic
1005314938 6:24595722-24595744 TTCTTGCCACCACCTGAGACAGG + Intronic
1005553027 6:26943352-26943374 TGGTGGCTTCCACATGAGGCTGG + Intergenic
1008043386 6:46826825-46826847 TTCTAGTGTCCACATGAATCTGG + Intronic
1015995179 6:138989249-138989271 ATTTTGCCTCCAAATGAGGCAGG - Intergenic
1018045433 6:159961851-159961873 ATATAGCCTCCACATGTGGCCGG - Intergenic
1021934911 7:25620797-25620819 ATCTACCCTCCACAGGACGCTGG + Intergenic
1022330220 7:29371706-29371728 TTCTATTCTGAACATGAGGCTGG - Intronic
1023499770 7:40835158-40835180 TTCAAACACCCACATGAGGCTGG + Intronic
1025208104 7:57004841-57004863 ATCTGGGCTCCACATGAGGGTGG - Intergenic
1025663850 7:63572034-63572056 ATCTGGGCTCCACATGAGGGTGG + Intergenic
1026258309 7:68732111-68732133 TTCTTGCCTCCACATGACCGAGG - Intergenic
1028549592 7:92045145-92045167 TTCTGACCTCCAAATTAGGCTGG - Exonic
1030073234 7:105715273-105715295 TTCCATTCTCCACATGAGGAAGG - Intronic
1034123049 7:148644693-148644715 TCATAGCATCCACATGAGGAAGG - Intergenic
1039418426 8:37415942-37415964 TTCTTGCCTCCATATGAAGAAGG - Intergenic
1039659637 8:39448338-39448360 GTCTAGCCACCACATGGGACTGG + Intergenic
1042222557 8:66487586-66487608 CTCCAGCCTCCAGCTGAGGCAGG + Intronic
1043999015 8:86855256-86855278 CTCTATCCTCCACATTAGTCAGG - Intergenic
1044036832 8:87315547-87315569 TGCTAGTTTCCACATGAGCCTGG - Intronic
1044750886 8:95414433-95414455 TTCTTGTCCCCACATGAGGCTGG + Intergenic
1049378413 8:142300433-142300455 CTCCACACTCCACATGAGGCTGG - Intronic
1058710254 9:107672892-107672914 TCATAGCCTCCCTATGAGGCTGG - Intergenic
1058969996 9:110072420-110072442 TTCTATCATCCACATGATTCTGG - Intronic
1058991648 9:110259291-110259313 GTCCAGCCTCCACATGGGACTGG + Intergenic
1060846169 9:126839330-126839352 TTCTAGCCTTTATTTGAGGCAGG + Intergenic
1187197712 X:17103950-17103972 TTCTCTCTTCCACATGAGGCTGG - Intronic
1190493159 X:51002889-51002911 TTCTACCCTACACATAAGGACGG + Intergenic
1199766664 X:150946461-150946483 TGCTAGGCTGCACAGGAGGCTGG + Intergenic
1200184144 X:154170694-154170716 CTCTAGCCTCCTAATGAGCCAGG - Intergenic
1200189798 X:154207822-154207844 CTCTAGCCTCCTAATGAGCCAGG - Intergenic
1200195551 X:154245631-154245653 CTCTAGCCTCCTAATGAGCCAGG - Intergenic
1200201203 X:154282752-154282774 CTCTAGCCTCCTAATGAGCCAGG - Intronic