ID: 1152899840

View in Genome Browser
Species Human (GRCh38)
Location 17:82934162-82934184
Sequence CTGAGCGAGCTCTGCAGACT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 127
Summary {0: 1, 1: 0, 2: 2, 3: 9, 4: 115}

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152899838_1152899840 -6 Left 1152899838 17:82934145-82934167 CCTCTGGTGCTCAGAACCTGAGC 0: 1
1: 0
2: 1
3: 18
4: 193
Right 1152899840 17:82934162-82934184 CTGAGCGAGCTCTGCAGACTTGG 0: 1
1: 0
2: 2
3: 9
4: 115
1152899826_1152899840 28 Left 1152899826 17:82934111-82934133 CCCAGGTTAGTCCTCAGCGGCCC 0: 1
1: 0
2: 0
3: 8
4: 67
Right 1152899840 17:82934162-82934184 CTGAGCGAGCTCTGCAGACTTGG 0: 1
1: 0
2: 2
3: 9
4: 115
1152899831_1152899840 8 Left 1152899831 17:82934131-82934153 CCCCCAGGAAGCCCCCTCTGGTG 0: 1
1: 0
2: 12
3: 95
4: 489
Right 1152899840 17:82934162-82934184 CTGAGCGAGCTCTGCAGACTTGG 0: 1
1: 0
2: 2
3: 9
4: 115
1152899833_1152899840 6 Left 1152899833 17:82934133-82934155 CCCAGGAAGCCCCCTCTGGTGCT 0: 1
1: 0
2: 3
3: 20
4: 206
Right 1152899840 17:82934162-82934184 CTGAGCGAGCTCTGCAGACTTGG 0: 1
1: 0
2: 2
3: 9
4: 115
1152899832_1152899840 7 Left 1152899832 17:82934132-82934154 CCCCAGGAAGCCCCCTCTGGTGC 0: 1
1: 0
2: 3
3: 29
4: 234
Right 1152899840 17:82934162-82934184 CTGAGCGAGCTCTGCAGACTTGG 0: 1
1: 0
2: 2
3: 9
4: 115
1152899834_1152899840 5 Left 1152899834 17:82934134-82934156 CCAGGAAGCCCCCTCTGGTGCTC 0: 1
1: 0
2: 3
3: 39
4: 292
Right 1152899840 17:82934162-82934184 CTGAGCGAGCTCTGCAGACTTGG 0: 1
1: 0
2: 2
3: 9
4: 115
1152899829_1152899840 17 Left 1152899829 17:82934122-82934144 CCTCAGCGGCCCCCAGGAAGCCC 0: 1
1: 0
2: 5
3: 42
4: 427
Right 1152899840 17:82934162-82934184 CTGAGCGAGCTCTGCAGACTTGG 0: 1
1: 0
2: 2
3: 9
4: 115
1152899836_1152899840 -4 Left 1152899836 17:82934143-82934165 CCCCTCTGGTGCTCAGAACCTGA 0: 1
1: 0
2: 0
3: 14
4: 193
Right 1152899840 17:82934162-82934184 CTGAGCGAGCTCTGCAGACTTGG 0: 1
1: 0
2: 2
3: 9
4: 115
1152899827_1152899840 27 Left 1152899827 17:82934112-82934134 CCAGGTTAGTCCTCAGCGGCCCC 0: 1
1: 0
2: 1
3: 4
4: 81
Right 1152899840 17:82934162-82934184 CTGAGCGAGCTCTGCAGACTTGG 0: 1
1: 0
2: 2
3: 9
4: 115
1152899837_1152899840 -5 Left 1152899837 17:82934144-82934166 CCCTCTGGTGCTCAGAACCTGAG 0: 1
1: 0
2: 2
3: 18
4: 194
Right 1152899840 17:82934162-82934184 CTGAGCGAGCTCTGCAGACTTGG 0: 1
1: 0
2: 2
3: 9
4: 115
1152899835_1152899840 -3 Left 1152899835 17:82934142-82934164 CCCCCTCTGGTGCTCAGAACCTG 0: 1
1: 0
2: 1
3: 21
4: 234
Right 1152899840 17:82934162-82934184 CTGAGCGAGCTCTGCAGACTTGG 0: 1
1: 0
2: 2
3: 9
4: 115

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152899840 Original CRISPR CTGAGCGAGCTCTGCAGACT TGG Intronic