ID: 1152899840

View in Genome Browser
Species Human (GRCh38)
Location 17:82934162-82934184
Sequence CTGAGCGAGCTCTGCAGACT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 127
Summary {0: 1, 1: 0, 2: 2, 3: 9, 4: 115}

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152899826_1152899840 28 Left 1152899826 17:82934111-82934133 CCCAGGTTAGTCCTCAGCGGCCC 0: 1
1: 0
2: 0
3: 8
4: 67
Right 1152899840 17:82934162-82934184 CTGAGCGAGCTCTGCAGACTTGG 0: 1
1: 0
2: 2
3: 9
4: 115
1152899829_1152899840 17 Left 1152899829 17:82934122-82934144 CCTCAGCGGCCCCCAGGAAGCCC 0: 1
1: 0
2: 5
3: 42
4: 427
Right 1152899840 17:82934162-82934184 CTGAGCGAGCTCTGCAGACTTGG 0: 1
1: 0
2: 2
3: 9
4: 115
1152899827_1152899840 27 Left 1152899827 17:82934112-82934134 CCAGGTTAGTCCTCAGCGGCCCC 0: 1
1: 0
2: 1
3: 4
4: 81
Right 1152899840 17:82934162-82934184 CTGAGCGAGCTCTGCAGACTTGG 0: 1
1: 0
2: 2
3: 9
4: 115
1152899837_1152899840 -5 Left 1152899837 17:82934144-82934166 CCCTCTGGTGCTCAGAACCTGAG 0: 1
1: 0
2: 2
3: 18
4: 194
Right 1152899840 17:82934162-82934184 CTGAGCGAGCTCTGCAGACTTGG 0: 1
1: 0
2: 2
3: 9
4: 115
1152899831_1152899840 8 Left 1152899831 17:82934131-82934153 CCCCCAGGAAGCCCCCTCTGGTG 0: 1
1: 0
2: 12
3: 95
4: 489
Right 1152899840 17:82934162-82934184 CTGAGCGAGCTCTGCAGACTTGG 0: 1
1: 0
2: 2
3: 9
4: 115
1152899834_1152899840 5 Left 1152899834 17:82934134-82934156 CCAGGAAGCCCCCTCTGGTGCTC 0: 1
1: 0
2: 3
3: 39
4: 292
Right 1152899840 17:82934162-82934184 CTGAGCGAGCTCTGCAGACTTGG 0: 1
1: 0
2: 2
3: 9
4: 115
1152899832_1152899840 7 Left 1152899832 17:82934132-82934154 CCCCAGGAAGCCCCCTCTGGTGC 0: 1
1: 0
2: 3
3: 29
4: 234
Right 1152899840 17:82934162-82934184 CTGAGCGAGCTCTGCAGACTTGG 0: 1
1: 0
2: 2
3: 9
4: 115
1152899833_1152899840 6 Left 1152899833 17:82934133-82934155 CCCAGGAAGCCCCCTCTGGTGCT 0: 1
1: 0
2: 3
3: 20
4: 206
Right 1152899840 17:82934162-82934184 CTGAGCGAGCTCTGCAGACTTGG 0: 1
1: 0
2: 2
3: 9
4: 115
1152899836_1152899840 -4 Left 1152899836 17:82934143-82934165 CCCCTCTGGTGCTCAGAACCTGA 0: 1
1: 0
2: 0
3: 14
4: 193
Right 1152899840 17:82934162-82934184 CTGAGCGAGCTCTGCAGACTTGG 0: 1
1: 0
2: 2
3: 9
4: 115
1152899838_1152899840 -6 Left 1152899838 17:82934145-82934167 CCTCTGGTGCTCAGAACCTGAGC 0: 1
1: 0
2: 1
3: 18
4: 193
Right 1152899840 17:82934162-82934184 CTGAGCGAGCTCTGCAGACTTGG 0: 1
1: 0
2: 2
3: 9
4: 115
1152899835_1152899840 -3 Left 1152899835 17:82934142-82934164 CCCCCTCTGGTGCTCAGAACCTG 0: 1
1: 0
2: 1
3: 21
4: 234
Right 1152899840 17:82934162-82934184 CTGAGCGAGCTCTGCAGACTTGG 0: 1
1: 0
2: 2
3: 9
4: 115

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152899840 Original CRISPR CTGAGCGAGCTCTGCAGACT TGG Intronic
900194973 1:1371482-1371504 CAGGGTGAGCTCTGCAGGCTGGG + Intergenic
902435503 1:16395916-16395938 CTGGGCTAGCTCTGTAGGCTCGG + Exonic
902545237 1:17185723-17185745 CAGAGGGAGCTCTGCACACATGG + Intergenic
905591597 1:39168574-39168596 CTCAGGGAGCTCTGCAGAGGCGG - Intronic
905618955 1:39424098-39424120 ATCAGCCAGCTCTGCTGACTGGG - Exonic
907262290 1:53228538-53228560 CTGAGAAAGCTATTCAGACTCGG + Intronic
915107754 1:153545022-153545044 CTGCGCAAGCTCTGGAGATTCGG + Intronic
915211031 1:154309603-154309625 GTGAGCTAACTCTGCAGGCTTGG + Intergenic
917603924 1:176605787-176605809 CTGAGAGAGATTTGCAGACCTGG - Intronic
921189603 1:212698455-212698477 GTCAGTGAACTCTGCAGACTTGG + Intronic
1064872551 10:19955122-19955144 CTGAGCAAGCACTCCAGCCTGGG - Intronic
1064936872 10:20687980-20688002 CTGGGCCACCTCTGCAGCCTGGG + Intergenic
1066303028 10:34113766-34113788 CTGGGCGAGTTCTGCTCACTGGG + Intronic
1069794938 10:71046079-71046101 CGAAGAGAGCTCTGCAGCCTGGG - Intergenic
1075721376 10:124589604-124589626 CCGGGTGAGCTCTGCACACTGGG - Intronic
1075839206 10:125485061-125485083 CTGAGCTAGCTCTGAACACACGG - Intergenic
1076581541 10:131515526-131515548 CTGAGCTATCTCTGCAGACTCGG + Intergenic
1076760493 10:132603424-132603446 TTGCTGGAGCTCTGCAGACTGGG - Intronic
1080641899 11:34163065-34163087 CTGAGCGAGCTCTGCCATCCTGG + Intronic
1087175222 11:95089861-95089883 CGGCGCGAGCTCTGCAGGCTGGG - Exonic
1089280386 11:117370209-117370231 CTCACCGAGCACTGCCGACTTGG - Intronic
1091219793 11:133923472-133923494 CATAACGAGCTCTGTAGACTTGG - Intronic
1091606282 12:1954676-1954698 CAGAGCTAGCACTGTAGACTGGG - Intronic
1092290800 12:7158506-7158528 CTGAGGGAGCCCTGCAGAGGGGG - Exonic
1094018160 12:25885505-25885527 CTCAGAGAGCTCTCCAGTCTGGG - Intergenic
1096583286 12:52602024-52602046 CTGAGAGGTCTCTGCAGACGGGG - Intergenic
1101355909 12:103977480-103977502 CTGAGGGAGCTATACAGGCTGGG + Intronic
1102768327 12:115452036-115452058 CTGAGCGGCCGCTGCAGACTCGG + Intergenic
1104898105 12:132174042-132174064 CTGAGCCCCCTCTGCTGACTGGG + Intergenic
1104906543 12:132216489-132216511 CTGAGCGCAGTCTGCAGCCTCGG + Intronic
1112229949 13:97579787-97579809 CAGAGAGGGCTCTGCAGACCGGG - Intergenic
1114742474 14:25111932-25111954 CTGAACAAGTTCTTCAGACTTGG - Intergenic
1119354542 14:73994784-73994806 ACGAGCAAGCTGTGCAGACTCGG - Intronic
1119403213 14:74378447-74378469 CTCCGCGAGCTCCGCAGCCTTGG + Intergenic
1121568902 14:94931682-94931704 CTGAGCTTGCACTGCAGACCAGG - Intergenic
1122867378 14:104613336-104613358 AGGAGGGAGCTCTGCAGCCTGGG - Intergenic
1122912265 14:104836719-104836741 CTCCGCGAGCTCCGCAGCCTTGG + Intergenic
1122929106 14:104925330-104925352 CTGAGAGACCCCTGCAGAGTAGG - Intronic
1123154446 14:106210851-106210873 CTGAGCGCCCTCTGCAGCCCAGG + Intergenic
1127973073 15:63977378-63977400 CTGGGTCTGCTCTGCAGACTGGG + Intronic
1128384075 15:67134872-67134894 CTGAGAGATTTCTGCAGACAAGG + Intronic
1131003935 15:88960503-88960525 CTGAGCCAGCTCGTCATACTGGG - Intergenic
1131824612 15:96308530-96308552 CTGAAAGAGCTGAGCAGACTCGG + Intergenic
1134767996 16:16778550-16778572 CAGACCCAGCTCTGCAGCCTGGG - Intergenic
1135338617 16:21627265-21627287 CTGAGTGTGCTTTGCATACTTGG + Intronic
1139490042 16:67281035-67281057 CTGAGCCAGCTGTGAGGACTGGG + Intronic
1145963504 17:28901334-28901356 CAGAAGGAGCTCTGCAGCCTTGG + Intronic
1146739166 17:35266279-35266301 CTGAGCGTGCCAGGCAGACTCGG + Exonic
1148756512 17:49975910-49975932 CTGAGTGGGCTTTTCAGACTGGG - Intergenic
1151476209 17:74345533-74345555 CTTGCCGAGCTCTGCAGCCTTGG + Intronic
1151971227 17:77458421-77458443 CTCAGCGAGGTCTGCAGACAGGG + Intronic
1152899840 17:82934162-82934184 CTGAGCGAGCTCTGCAGACTTGG + Intronic
1159601201 18:70430374-70430396 CTCCGCGAGCTCCGCAGCCTCGG - Intergenic
1163237861 19:16039742-16039764 CTGACCAAGCCCTGCAGACTGGG + Intergenic
1164586634 19:29479993-29480015 CTAACCCAGCTCTGCAGTCTTGG + Intergenic
1165826547 19:38709023-38709045 CTGAGAGAGCACTGGGGACTGGG - Intronic
1168699590 19:58429000-58429022 CAGAGCTAGCTCTGAAGAATGGG - Intergenic
927964842 2:27262404-27262426 CAGAGGGAGCTCTGAAGCCTGGG + Intronic
932852395 2:75199886-75199908 CTGAGACAGCTCTGCAGAGGCGG + Intergenic
932882112 2:75512421-75512443 CTAAGAGAGTTCTGCAGACTGGG + Intronic
936433136 2:112481856-112481878 CAGATCGAGCCCTGCAAACTGGG + Intergenic
937242833 2:120473663-120473685 ATGAGCCAGCCCTGCTGACTGGG - Intergenic
940895660 2:159080165-159080187 CTGGGCTAGCTCTGTAGGCTCGG + Intronic
941482270 2:166030933-166030955 CTGAGAGAGCTTTGAAGGCTGGG - Intronic
946733845 2:222734545-222734567 CTGAGCCAGCTCTACTAACTTGG - Intergenic
948427744 2:237898499-237898521 CTGAGCCAGCTGTGCACACCTGG - Intronic
1170197966 20:13709840-13709862 CTGAGCCAGCTTTGCATACCTGG + Intergenic
1173795064 20:45854232-45854254 CTGGGCGAGCACTCCAGCCTGGG - Intronic
1174252077 20:49227335-49227357 CTGAGTAAGCTCTGCAGTCTAGG - Intronic
1177606871 21:23390962-23390984 CTGAGCTTTCTGTGCAGACTTGG - Intergenic
1179769524 21:43603994-43604016 ATGAGCCAGCTCTGCATTCTGGG + Intronic
1180145133 21:45914578-45914600 AAGAGCCAGATCTGCAGACTGGG - Intronic
1183470852 22:38005721-38005743 CTGAGCGAGGTCTGCAGAGTGGG + Intronic
1184100310 22:42338490-42338512 CTGAGCGAGCTCTTCGGGATTGG - Intronic
1184771389 22:46598812-46598834 CTAAGCGTGCTCTCCAGACAAGG - Intronic
950969929 3:17176152-17176174 CTTAGCATGCTCTGCATACTTGG - Intronic
953295499 3:41711329-41711351 CTGAGCTAGGTCTGCTGGCTAGG + Intronic
954104696 3:48403708-48403730 CTCAGCCAGCCCTGCAGTCTGGG + Intergenic
955008254 3:54989925-54989947 CTGAGCAAGCACTGCATGCTGGG - Intronic
958712243 3:97731387-97731409 CTGAGCTAGAGCTGCAGACATGG + Intronic
961555536 3:127694489-127694511 CAGAGCTAGCTCTGCAGACAGGG - Intronic
962752618 3:138444939-138444961 CTGAGCAAGCCCTCCAGCCTGGG + Intronic
964670468 3:159219835-159219857 CTGAGAGAGCACTGCAGGCTTGG - Intronic
967021587 3:185527671-185527693 CTGAGGGTGCCCTGCAGCCTGGG - Intronic
968880346 4:3295280-3295302 CTGAGTGGGCTCTGCAGGCCTGG + Intronic
969264642 4:6056476-6056498 CTAAACCAGCTCTGCAGACCTGG + Intronic
974819271 4:67045502-67045524 CTGACTGAGGTCTGCAAACTGGG + Intergenic
978723737 4:111946022-111946044 CTGAGTGAGCCATGCAGACAAGG - Intergenic
983778242 4:171635646-171635668 CTCAGAGAGCTAAGCAGACTGGG + Intergenic
985306710 4:188550446-188550468 GTGAGTGAGCACTGCACACTGGG - Intergenic
986046151 5:4040198-4040220 CTGCATGAGCTCTGCAGACCTGG - Intergenic
988499285 5:31770712-31770734 CTGGGAGAGCTCTACACACTGGG + Intronic
991111006 5:62899342-62899364 GTGAGCGAGAGCAGCAGACTGGG + Intergenic
991363393 5:65843846-65843868 CTGAGAGAGTGGTGCAGACTAGG + Intronic
992669365 5:79043407-79043429 CTGAGTGGGCTCTGCACATTTGG - Intronic
997691119 5:135828122-135828144 CTTAGAGAGCTCTGCAGCATGGG - Intergenic
999311199 5:150553390-150553412 CTGAGCCAGACCTGCAGAGTGGG + Exonic
1002442463 5:179271499-179271521 CTGAGCGAGTGCTCCAGACCCGG - Intronic
1002947967 6:1780717-1780739 GTGAGCGAGCCCTGCAGCCTGGG - Intronic
1003124180 6:3342473-3342495 TTCAGGGACCTCTGCAGACTGGG - Intronic
1006618550 6:35346234-35346256 CTGAGTGCTCTCTGCAGGCTGGG + Intronic
1008020803 6:46575387-46575409 CTGAGAGAGGCCAGCAGACTGGG - Intronic
1010124636 6:72417916-72417938 CTGAACGTGCTCAGCACACTCGG + Intergenic
1018091019 6:160347482-160347504 CTGATCGCGCTCTGCCGAATTGG + Intergenic
1021313308 7:19117635-19117657 TTGGGCGAGAGCTGCAGACTTGG + Exonic
1021825643 7:24548139-24548161 CTGAGTGATGTCTACAGACTAGG - Intergenic
1022244113 7:28541345-28541367 CTGAGTGGGGTCTGCTGACTGGG - Intronic
1023889763 7:44383779-44383801 GTGTGCCAGCTCTGGAGACTGGG + Exonic
1024115610 7:46190192-46190214 CAGAGCGAGCTAAGCGGACTTGG - Intergenic
1024145887 7:46515919-46515941 CAGAGGTAGCTCTGCAGACAGGG - Intergenic
1034493203 7:151405286-151405308 CTGAGGGAGCCCTGCAGGGTCGG - Intronic
1035014632 7:155754350-155754372 CTGAGCAAGTTCTGCAGAACAGG - Intronic
1037992900 8:23333238-23333260 CTGAGCGCCCTCTGCAGAGAAGG - Intronic
1040419196 8:47223248-47223270 CTGACAGGGCTCTGCACACTAGG - Intergenic
1041047763 8:53903551-53903573 CTCTGCCAGCTCTGCAGCCTTGG + Intronic
1048182610 8:132210063-132210085 CACAGCTAGCTTTGCAGACTGGG - Intronic
1050695315 9:8273072-8273094 CTGAGCCAGGTTTGCATACTGGG + Intergenic
1060229562 9:121816815-121816837 ATGAAGGAGCTCTGCAGAATAGG - Intergenic
1192442259 X:71183258-71183280 CTGAGAGCACTTTGCAGACTGGG - Intergenic
1195682638 X:107560362-107560384 TTGAGCGAGATCTTCTGACTAGG - Exonic
1196107507 X:111912453-111912475 CTGAGAGAGCTCCTCATACTCGG + Exonic
1200182196 X:154157352-154157374 CTTAATGAACTCTGCAGACTTGG - Intronic
1200187850 X:154194466-154194488 CTTAATGAACTCTGCAGACTTGG - Intergenic
1200193500 X:154231606-154231628 CTTAATGAACTCTGCAGACTTGG - Intronic
1200199255 X:154269410-154269432 CTTAATGAACTCTGCAGACTTGG - Intronic
1201603343 Y:15756367-15756389 CTGAATGACCTCTGCAGCCTTGG + Intergenic
1201748163 Y:17403229-17403251 CTGAGCAAGTTCTGCAGATGGGG + Intergenic