ID: 1152901476

View in Genome Browser
Species Human (GRCh38)
Location 17:82943518-82943540
Sequence CCCTGGCCTGCTCTCAGGTG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 413
Summary {0: 1, 1: 0, 2: 1, 3: 44, 4: 367}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152901463_1152901476 29 Left 1152901463 17:82943466-82943488 CCTATGTGAGGAGCCCAGGGGTG 0: 1
1: 0
2: 2
3: 16
4: 241
Right 1152901476 17:82943518-82943540 CCCTGGCCTGCTCTCAGGTGGGG 0: 1
1: 0
2: 1
3: 44
4: 367
1152901462_1152901476 30 Left 1152901462 17:82943465-82943487 CCCTATGTGAGGAGCCCAGGGGT 0: 1
1: 0
2: 0
3: 10
4: 148
Right 1152901476 17:82943518-82943540 CCCTGGCCTGCTCTCAGGTGGGG 0: 1
1: 0
2: 1
3: 44
4: 367
1152901467_1152901476 6 Left 1152901467 17:82943489-82943511 CCATGTGCGTGGTGTAGATTAGG 0: 1
1: 0
2: 0
3: 1
4: 70
Right 1152901476 17:82943518-82943540 CCCTGGCCTGCTCTCAGGTGGGG 0: 1
1: 0
2: 1
3: 44
4: 367
1152901466_1152901476 15 Left 1152901466 17:82943480-82943502 CCAGGGGTGCCATGTGCGTGGTG 0: 1
1: 0
2: 0
3: 16
4: 142
Right 1152901476 17:82943518-82943540 CCCTGGCCTGCTCTCAGGTGGGG 0: 1
1: 0
2: 1
3: 44
4: 367
1152901465_1152901476 16 Left 1152901465 17:82943479-82943501 CCCAGGGGTGCCATGTGCGTGGT 0: 1
1: 0
2: 0
3: 6
4: 80
Right 1152901476 17:82943518-82943540 CCCTGGCCTGCTCTCAGGTGGGG 0: 1
1: 0
2: 1
3: 44
4: 367

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152901476 Original CRISPR CCCTGGCCTGCTCTCAGGTG GGG Intronic
900002770 1:23985-24007 GCCTGGCTTGGTCTCAGGTCAGG - Intergenic
900022491 1:194510-194532 GCCTGGCTTGGTCTCAGGTCAGG - Intergenic
900436667 1:2634298-2634320 GCCTGGCCTACTCTCAGCAGGGG + Intergenic
900511868 1:3064648-3064670 CCCTGCACTGCTCAAAGGTGGGG - Intergenic
900518586 1:3095028-3095050 CCCTGGCCTACTCCCCGGTTGGG + Intronic
900784280 1:4637980-4638002 CACTGACCTGCTCCAAGGTGAGG - Intergenic
901665756 1:10825214-10825236 CCCTGGTCTGCTGCCAGGTAGGG + Intergenic
901740507 1:11338827-11338849 CCCTGCATTGCTCTCAGCTGCGG - Intergenic
901807878 1:11749413-11749435 CCTGGGCCTGCCCCCAGGTGAGG + Intronic
901883893 1:12209479-12209501 CCTGGGCCTGCTCTCAGGACCGG + Intergenic
902300899 1:15502152-15502174 CCCTGGTCAGCTCTGAGGGGAGG - Intronic
902376962 1:16034484-16034506 CCTTGGCCTGGTCTCTGCTGGGG - Intergenic
902382132 1:16057743-16057765 CCTTGGCCTGGTCTCTGCTGGGG - Intergenic
902764085 1:18603407-18603429 CCCTGGCCTGCTGGGAGGAGAGG - Intergenic
904260237 1:29283789-29283811 CCCAGGCCTGCCTTCGGGTGGGG + Intronic
905300896 1:36985591-36985613 CCCTGGATGGGTCTCAGGTGTGG + Intronic
906506018 1:46380185-46380207 CCCTGGCACCCTCTGAGGTGGGG - Intergenic
907160011 1:52362741-52362763 TCCTGCTCTGCTCTCAGATGGGG - Exonic
909068456 1:70963648-70963670 CCCTGGCCTGCACACAGCAGGGG + Intronic
911226177 1:95307913-95307935 CTCTGGACTGATCTCATGTGAGG - Intergenic
911661696 1:100508730-100508752 CCCTGGCCTGAAATCAGGGGTGG - Intronic
912359744 1:109085372-109085394 CCTAGGCCTGGTTTCAGGTGTGG + Intergenic
912579173 1:110704744-110704766 CCCTAGGCTGCACACAGGTGGGG + Intergenic
912747559 1:112258027-112258049 CCCTGTACTCCTCTCATGTGTGG + Intergenic
913558577 1:119995119-119995141 CCCTGGCAGCCTCTCAGCTGCGG + Intronic
913639264 1:120795352-120795374 CCCTGGCAGCCTCTCAGCTGCGG - Intergenic
913647331 1:120871014-120871036 CTGTGGCCTGCTCTGTGGTGGGG - Intergenic
914218568 1:145656417-145656439 CCCTGTGCGGCTCCCAGGTGGGG + Intronic
914279186 1:146154606-146154628 CCCTGGCAGCCTCTCAGCTGCGG + Intronic
914471127 1:147979108-147979130 CCCTGTGCGGCTCCCAGGTGGGG + Intronic
914626415 1:149465678-149465700 CCCTGGCAGCCTCTCAGCTGCGG - Intergenic
915706692 1:157850732-157850754 CCCTGGACTGCTGTCTGCTGAGG + Intronic
917799081 1:178553790-178553812 TCCTCTCCTGCTCTGAGGTGTGG + Intergenic
918042477 1:180921642-180921664 GCCTGCTCTGTTCTCAGGTGTGG + Intronic
920792694 1:209107763-209107785 CCCAGGCCTGGTTTCAGGTCTGG + Intergenic
922028328 1:221774150-221774172 CCCTCTCCTGCCCTCAGGTCTGG - Intergenic
922078250 1:222268953-222268975 ACCTGGTCTGCTCTCAAATGGGG + Intergenic
922316839 1:224449885-224449907 CTGTGGCCTGCTTTCAGTTGTGG + Intronic
922686329 1:227641152-227641174 CTATGGCCTGCTCTCCGGAGTGG + Intronic
922785116 1:228278770-228278792 CCCGGGCCAGCGCCCAGGTGCGG + Exonic
923497549 1:234538586-234538608 CTCTTGCCAGCTCTCAGGGGAGG - Intergenic
924302392 1:242652493-242652515 TCCTGGCCAGATCTCAGGGGAGG - Intergenic
1063122623 10:3115372-3115394 CCCAGTCCTGTTCTCAGCTGCGG - Intronic
1063767380 10:9158239-9158261 CCCAGGGCTTCGCTCAGGTGAGG + Intergenic
1065917865 10:30367606-30367628 CCCTGGGCTCCTCCCAGGTGTGG - Intronic
1066673735 10:37866084-37866106 CCCAGGCCTGGTTTCAGGTCTGG - Intergenic
1067054146 10:43041540-43041562 TTCAGGCCAGCTCTCAGGTGAGG - Intergenic
1067175185 10:43940931-43940953 CCCTAGCTTGTTCTCAGATGTGG + Intergenic
1067587011 10:47482215-47482237 CCCTAGCCAGCTCTCACATGGGG + Intronic
1067682345 10:48449040-48449062 CTCTGGCCTGCTCTGAGGCCTGG - Intronic
1069320089 10:67159019-67159041 CCCAGGCCTGGTTTCAGGCGTGG - Intronic
1069620293 10:69833333-69833355 TCCTGGCCTGGGCTGAGGTGAGG - Intronic
1069815805 10:71193650-71193672 CCCTGGCCTAATCTCAGCTCAGG + Intergenic
1070360461 10:75683655-75683677 CCTTGGCCAGCTTTCAGGTAAGG - Intronic
1070642553 10:78180129-78180151 CCCTGCCCTGCTCACAGAGGGGG + Intergenic
1071561598 10:86650177-86650199 CCCTGCTCTGCTCTCTGTTGCGG + Intergenic
1072770419 10:98133193-98133215 CCCAGGCCTGGTTTCAGGTCTGG - Intergenic
1074518849 10:114198448-114198470 CCCCAACCTGCTCACAGGTGTGG - Intronic
1074534766 10:114320804-114320826 CACTTCCCTGCTCCCAGGTGTGG - Intronic
1076450828 10:130555982-130556004 ACCTGGCCCCTTCTCAGGTGAGG + Intergenic
1077169234 11:1158997-1159019 CCCGGGGCTGCTCCCAGGAGAGG + Intronic
1077554415 11:3219030-3219052 CCAGGGCCTGCCCTCAGGTATGG - Intergenic
1078318993 11:10317165-10317187 TCCTGGCCTGCTCACTTGTGGGG + Intronic
1078536954 11:12182919-12182941 CCCAGGCCTGCTATCAGCTGGGG - Intronic
1078845927 11:15118278-15118300 CCCTGCCCTGCATTCAGATGAGG - Intronic
1079139460 11:17798351-17798373 CACTGGGCTGCTGTCAGATGAGG - Intronic
1080153099 11:29076579-29076601 TCCTGGCCAGATCTCAGGGGAGG - Intergenic
1081351470 11:42057709-42057731 CCATGGCCTGTTGTGAGGTGGGG + Intergenic
1081806967 11:45896150-45896172 CACTGGCCTGCCCTTAGCTGTGG + Intronic
1083622007 11:64053805-64053827 CCCTTGCCTGCCCGCAGATGGGG + Intronic
1083899359 11:65636287-65636309 ACCTGCCGTGTTCTCAGGTGTGG - Exonic
1084196665 11:67526583-67526605 CCCCGGCCTGTCCTCAGATGTGG - Intergenic
1085217475 11:74845008-74845030 CCCTGACTTGCTCTGAGCTGTGG + Intronic
1085532941 11:77202518-77202540 CCAGGCCCTGCTCACAGGTGGGG - Intronic
1087760899 11:102103521-102103543 CCCTTGCCTACTCTGGGGTGGGG + Intergenic
1088920358 11:114256469-114256491 ACCTGGCCTGGTATCAGGAGAGG - Intergenic
1089611542 11:119672209-119672231 CCCTGTCCTGCTCTTGGGAGTGG + Intronic
1089634410 11:119803279-119803301 CCCTGGGCTGCTCTCTAGGGTGG - Intergenic
1090802242 11:130180161-130180183 CCCTGTCCTTGTCTCAGGTCTGG + Intronic
1091168260 11:133499445-133499467 CCCTGGCCTCCCCTCCTGTGGGG + Intronic
1091376189 12:26048-26070 GCCTGGCTTGGTCTCAGGTCAGG - Intergenic
1091990947 12:4955476-4955498 ACCTGGGCTGCTGTGAGGTGGGG + Intergenic
1092028999 12:5268324-5268346 CCCTAGCCTCCTCTAAGGTGTGG - Intergenic
1092055281 12:5503950-5503972 CTCTGTCCTGCTGTCAGGGGTGG + Intronic
1092326893 12:7542221-7542243 CCCTGGCCTGATTTCAGGTCTGG - Intergenic
1096934025 12:55249909-55249931 CCGGGGCCTGCTGTGAGGTGGGG - Intergenic
1097232355 12:57520549-57520571 CCTTGCCCTCCTCTCAGGGGCGG + Intergenic
1098133834 12:67380673-67380695 CCGGGGCCTGCTGGCAGGTGGGG - Intergenic
1099299094 12:80868820-80868842 CTCTGGGCTGGTTTCAGGTGGGG + Intronic
1100326371 12:93543506-93543528 CCCTCTCCTGCTCTCAGAGGTGG - Intergenic
1102581372 12:113890341-113890363 CCCTGCCTTGCTCTCTGGTGGGG + Intronic
1103311169 12:120009612-120009634 CCCTTGCCTGATGTGAGGTGGGG + Intronic
1104859359 12:131916547-131916569 CCCTGGCCTGCGGCCAGGCGAGG + Exonic
1104983627 12:132584929-132584951 GCCTGGCCTCCTCTCAGTTTGGG + Exonic
1105898871 13:24740399-24740421 CCCTGGCCTGTTCTCCAGAGAGG + Intergenic
1107447272 13:40480440-40480462 CCCTTGGCTGCTCTCCGGTGTGG - Intergenic
1107658245 13:42613700-42613722 CCATGGCCCGACCTCAGGTGTGG + Intergenic
1108715239 13:53072163-53072185 CCCTGGCCTTCTCTGAGCTTTGG + Intergenic
1113649720 13:112027013-112027035 CCTTCCCCTGCTCTCAGATGTGG - Intergenic
1113769040 13:112896998-112897020 GCCTGGCCTCCTCTCAGGGTGGG - Intronic
1113850337 13:113414124-113414146 CCCTGCCCTTCTCTCAGAGGAGG - Intergenic
1113894601 13:113755543-113755565 CCCTGGGCTGCTCTCAGTGGTGG + Intergenic
1114237626 14:20836225-20836247 CTGTGGCCTGCTCTCCGGGGTGG + Intergenic
1114564075 14:23615173-23615195 CCCTGGCCTTCTCCCAGCTCTGG + Intergenic
1116047555 14:39763275-39763297 CCCAGGCCTGGTTTCAGGTCTGG + Intergenic
1117235867 14:53774002-53774024 TCCTGGCTTGCTCCCAGATGTGG - Intergenic
1118137594 14:63045959-63045981 CCCTGCCCTGCTCTCAGCCTCGG - Intronic
1118784775 14:69037121-69037143 GCCTGGCGTGCTCTCAGAGGGGG + Intergenic
1119711609 14:76826567-76826589 CCCTGGGATGCCCCCAGGTGAGG + Exonic
1120890171 14:89484603-89484625 CCCTGGCCTGGGCTTAGGAGGGG + Intronic
1121325918 14:93019537-93019559 GCCTGGGCTGCTCTCGGGTGCGG + Intronic
1122108603 14:99480318-99480340 CTCGCGCCTGCTCTCGGGTGGGG - Intronic
1122292704 14:100688169-100688191 CACTGCCCTGCTCACAGCTGGGG + Intergenic
1122349475 14:101079079-101079101 CCCTGCCCTGCTCTCGGGAAAGG - Intergenic
1122812277 14:104295054-104295076 CCCTGCCCTGCCCTGTGGTGGGG + Intergenic
1123017652 14:105383062-105383084 GCCTGGCCTCCCCTCAGTTGTGG + Intronic
1123473187 15:20569592-20569614 CCCTGGGCTCCTCCCAGGTCTGG + Intergenic
1123495683 15:20823173-20823195 CCTTTGCCTGGTGTCAGGTGGGG - Intergenic
1123552170 15:21392265-21392287 CCTTTGCCTGGTGTCAGGTGGGG - Intergenic
1123588414 15:21829662-21829684 CCTTTGCCTGGTGTCAGGTGGGG - Intergenic
1123644819 15:22430761-22430783 CCCTGGGCTCCTCCCAGGTCTGG - Intergenic
1123666120 15:22610554-22610576 CCCTGGGCTCCTCTCAGGTCTGG - Intergenic
1123733488 15:23164603-23164625 CCCTGGGCTCCTCCCAGGTCTGG + Intergenic
1123751618 15:23361978-23362000 CCCTGGGCTCCTCCCAGGTCTGG + Intronic
1123758565 15:23415735-23415757 CCCTGGCCTGATCTCTGCTGGGG - Intergenic
1124254736 15:28131376-28131398 GCCTGGCCTCCTCTCTCGTGGGG - Intronic
1124283991 15:28385903-28385925 CCCTGGGCTCCTCCCAGGTCTGG + Intronic
1124298706 15:28525711-28525733 CCCTGGGCTCCTCCCAGGTCTGG - Intronic
1124319943 15:28704960-28704982 CCCTGGGCTCCTCTCAGGTCTGG - Intronic
1124441233 15:29687835-29687857 TCCTTTCCTGCTGTCAGGTGGGG + Intergenic
1124482567 15:30090463-30090485 CCCTGGGCTCCTCTAAGGTCTGG + Intronic
1124489023 15:30142559-30142581 CCCTGGGATCCTCTCAGGTCTGG + Intronic
1124521010 15:30406746-30406768 CCCTGGGCTCCTCTCAGGTCTGG - Intronic
1124537652 15:30559474-30559496 CCCTGGGCTCCTCTCAGGTCTGG + Intronic
1124544108 15:30611529-30611551 CCCTGGGCTCCTCTCAGGTCTGG + Intronic
1124564072 15:30798964-30798986 CCCTGGGCTCCTCTCAGGTCTGG + Intergenic
1124754507 15:32395764-32395786 CCCTGGGCTCCTCTCAGGTCTGG - Intronic
1124761004 15:32448113-32448135 CCCTGGGCTCCTCTCAGGTCTGG - Intronic
1124777630 15:32600950-32600972 CCCTGGGCTCCTCTCAGGTCTGG + Intronic
1125327107 15:38547324-38547346 GCCTGCCCTGCACACAGGTGGGG - Intronic
1125510438 15:40289757-40289779 CTCTGGCCAGTTCTCATGTGTGG - Intronic
1128110257 15:65071678-65071700 CCTTCTCCTGCTCTCAGGAGAGG + Intronic
1129029913 15:72610540-72610562 CCCTGGGCTCCTCCCAGGTCTGG + Intergenic
1129038129 15:72663288-72663310 CCCTGGGCTCCTCCCAGGTCTGG + Intronic
1129211761 15:74073943-74073965 CCCTGGGCTCCTCCCAGGTCTGG - Intronic
1129360696 15:75022098-75022120 CCCTGCCCTGAGCTGAGGTGGGG - Intergenic
1129398642 15:75267141-75267163 CCCTGGGCTCCTCCCAGGTCTGG + Intronic
1129402250 15:75291417-75291439 CCCTGGGCTCCTCCCAGGTCTGG + Intronic
1129603741 15:77014714-77014736 CCCTGGCCGGCTCACAGGCCTGG + Intronic
1130484811 15:84392798-84392820 CCCTGGGCTCCTCCCAGGTCTGG + Intergenic
1130584995 15:85173882-85173904 CCCAGCCCTGCTCCCAGCTGGGG - Intergenic
1131110429 15:89761376-89761398 CTCTTGCCAGCTCTCGGGTGAGG + Intronic
1131282664 15:91033816-91033838 CCCTGGGCTCCTCCCAGGTCTGG - Intergenic
1131654698 15:94444078-94444100 GACTGGCCAGCTATCAGGTGGGG + Intronic
1132450741 15:101966954-101966976 GCCTGGCTTGGTCTCAGGTCAGG + Intergenic
1202960518 15_KI270727v1_random:119496-119518 CCTTTGCCTGGTGTCAGGTGGGG - Intergenic
1132481063 16:166305-166327 TCCTGGCAGGCGCTCAGGTGCGG - Exonic
1132584060 16:698470-698492 CCCTGGCCTGCCCAGAGGGGTGG - Intronic
1132639819 16:972645-972667 CCCTGCGCTGTCCTCAGGTGGGG + Intronic
1132872857 16:2123396-2123418 CCCTGGGCAGGACTCAGGTGTGG + Intronic
1133284938 16:4686362-4686384 CCCTCCCCTGCTCTCTGGCGGGG + Intronic
1133777411 16:8908088-8908110 CCCAGCCCTGCTCTCAGCTATGG - Intronic
1134457773 16:14407136-14407158 CCCTGGCCTGATCTCTGCTGGGG + Intergenic
1134551945 16:15142575-15142597 CCCTGGGCAGGACTCAGGTGTGG + Intergenic
1134745766 16:16587179-16587201 CCCTGGCCTGCTTCCACATGCGG + Intergenic
1134999715 16:18766563-18766585 CCCTGGCCTGCTTCCACATGCGG - Intergenic
1135718169 16:24790998-24791020 CCCAAACCTGCTCTGAGGTGGGG + Exonic
1136908095 16:34120514-34120536 TCCTGTTCTGCTCTCAGGTTGGG - Intergenic
1138205401 16:55120678-55120700 CCCTTGCCTGCTCTGAGCTGAGG - Intergenic
1138599795 16:58047618-58047640 GCCTGGCCTGCTCCGTGGTGGGG - Intergenic
1141091699 16:81134775-81134797 CCCAGGCCTGGTTTCAGGTCTGG - Intergenic
1141572214 16:84941044-84941066 TCCTGGCCGCCTCTCAGGAGGGG - Intergenic
1142288207 16:89180099-89180121 ACCTGCCCTGCTGTCAGCTGGGG + Intronic
1142400232 16:89854742-89854764 CCCTGGGCCGCTCTCTGGGGTGG - Intronic
1142483276 17:231380-231402 CCCTGGCCTGCACACAGGAAGGG - Intronic
1143289882 17:5820536-5820558 CCCTGGCCCCTTCTCAGGGGAGG + Intronic
1143451610 17:7040068-7040090 CCCAGGCCTGCTCTAGGGGGAGG - Exonic
1143845252 17:9768942-9768964 CCCTGACGTGCTCTCAGGATGGG - Intergenic
1144766281 17:17734532-17734554 CCCTGGTCTGCTCCCACGGGAGG - Intronic
1145213143 17:21030555-21030577 CACTTGCCTGCTCTGTGGTGGGG - Intronic
1145234289 17:21197831-21197853 CCCTGCCCTGCTCCTAGCTGCGG - Exonic
1146578570 17:34015395-34015417 CCCTGGTAGGCTCTCAGCTGTGG - Intronic
1147195333 17:38762694-38762716 CTCTGGCCTCTTGTCAGGTGAGG + Intronic
1149498570 17:57134561-57134583 CCCTGGCCTCCCCCCAGGTGTGG + Intergenic
1149784706 17:59425173-59425195 GCCTGACCTGCTGTCAGGGGAGG + Intergenic
1150007547 17:61479164-61479186 CCCTGGGGTGCTGTCAGCTGGGG + Intronic
1150342455 17:64379479-64379501 CCCTGGTCTGCTCTGAAGTTTGG - Intronic
1151344215 17:73491892-73491914 TCCTGGCCTCCTCTCAGATCTGG - Intronic
1152036380 17:77875604-77875626 CCAAGGCTGGCTCTCAGGTGTGG + Intergenic
1152394382 17:80023617-80023639 TCCTGGCCTGCACCGAGGTGAGG - Intronic
1152759281 17:82099553-82099575 CTCAGGCCTGCTCTCAGGAGAGG - Intergenic
1152901476 17:82943518-82943540 CCCTGGCCTGCTCTCAGGTGGGG + Intronic
1154327967 18:13405812-13405834 CCCTGTCCTGCTCTGAGCTGAGG + Intronic
1157333541 18:46720916-46720938 CCCTGCCCTGCCCACAGGGGAGG - Intronic
1157919021 18:51697056-51697078 CTGTGGCCTGCTCTCTGGGGTGG - Intergenic
1158676069 18:59519149-59519171 CACTGGCCTGCTCTCAGAGCTGG - Intronic
1160363940 18:78308325-78308347 CGCTCACCTGCTCTCAGGAGGGG + Intergenic
1160634521 19:65593-65615 GCCTGGCTTGGTCTCAGGTCAGG - Intergenic
1160811146 19:1013450-1013472 CCCTGGCCTGGTCAGTGGTGGGG - Intronic
1161357357 19:3826373-3826395 CCCCTCCCTGCTCTCAGGTGGGG + Intronic
1161447200 19:4325169-4325191 GGCTGGCCTGCCATCAGGTGAGG + Intronic
1162403404 19:10459578-10459600 CCCCTGCCTGCTCTCAGGAGCGG + Exonic
1162513176 19:11132041-11132063 ACGTGGCCTGCACCCAGGTGTGG + Exonic
1163061988 19:14767654-14767676 CCCTGGGCAGCTCCCAGCTGGGG + Intronic
1163575772 19:18110097-18110119 GCCGGGCCTGCGCGCAGGTGCGG + Intronic
1164126773 19:22325573-22325595 CTGTGCCCTGCTTTCAGGTGGGG + Intergenic
1164233680 19:23313576-23313598 CCGTGTCCTGCTTTCAGGAGGGG + Intronic
1164325812 19:24190529-24190551 CCGTGACCTGCTTTCAGGAGGGG - Intergenic
1167156720 19:47743224-47743246 CCCTTCCGTGCTCTCAGGGGCGG + Intergenic
1168115211 19:54218476-54218498 CCCTGCCCTGCTCCCAGATGGGG + Intronic
1168124495 19:54276070-54276092 CCCTGCCCTGCTCCCAGATGGGG + Intronic
1168382413 19:55935109-55935131 CCGAGGGCTGCTCACAGGTGAGG - Intergenic
925959942 2:9004387-9004409 CCCGGGGCTGCTCTCAGCTTTGG - Intergenic
926084107 2:10010268-10010290 CCCATGCCTGCTCTCCAGTGTGG - Intergenic
926916068 2:17893417-17893439 CCCTGGCCAGAACTCAGGAGAGG - Intronic
927517535 2:23680925-23680947 ACATGGCCTATTCTCAGGTGTGG - Intronic
927645254 2:24873334-24873356 CCCTCACCTGCTGGCAGGTGGGG - Intronic
929001038 2:37346869-37346891 CACTGGTCTGCTAACAGGTGAGG + Intronic
929456965 2:42072957-42072979 GCCTGGCCTGGGCTCAGGGGTGG - Intergenic
931779352 2:65566021-65566043 CCAAGGCCTGCTCTCAGATCTGG + Intergenic
932443652 2:71756764-71756786 CCATGGCCTGCTCCAAGGGGTGG + Intergenic
933051249 2:77605357-77605379 CCTTGGCCTGCTCTCAAGAATGG - Intergenic
934564419 2:95330422-95330444 CCCAGCCCTGCTCTCAGGGCAGG + Intronic
934985387 2:98881289-98881311 CTCCGACCTGCTCCCAGGTGGGG - Intronic
934986727 2:98892998-98893020 CCCTGGCCGGCTCCCGTGTGGGG + Intronic
935112494 2:100105402-100105424 CCCGGACCTGCTCTCCGTTGCGG + Intronic
936566954 2:113589434-113589456 GCCTGGCTTGGTCTCAGGTCAGG + Intergenic
937262820 2:120597290-120597312 CCCTGGCCTGAGCTCAAATGTGG - Intergenic
937872750 2:126797805-126797827 CCTTGGCCAGCTCTCAGAGGGGG + Intergenic
938305760 2:130253095-130253117 CCCTGGCCCGCTCTCGGCTCAGG + Intergenic
941978646 2:171432097-171432119 TCCTGGCTTGCACGCAGGTGTGG - Intronic
944908127 2:204283149-204283171 CCGTGGCCTGTTGTCGGGTGGGG - Intergenic
945135084 2:206618284-206618306 CCCTGGCCTGGTCTCCAATGGGG - Exonic
948019628 2:234719936-234719958 CCCTGCCCTGCTTTAAGGAGAGG + Intergenic
948423337 2:237873901-237873923 CCCTGGCCTCATCCCAGCTGTGG + Intronic
948427346 2:237896220-237896242 CCCAGGCCTGTTCTCAGAGGAGG + Intronic
948654259 2:239466813-239466835 CCCTGGCCTACTCTGGGGGGCGG + Intergenic
1168834763 20:870756-870778 CCTTCTCCTGCACTCAGGTGAGG - Exonic
1168925530 20:1575911-1575933 CCCTGACCTGCTCCCAAGTCAGG + Intronic
1168929408 20:1608939-1608961 CCCTGACCTGCTCCCAAGTCAGG + Intronic
1170904656 20:20502702-20502724 ACCTGGCCTGCTAGCAGGTGGGG - Intronic
1171903527 20:30879078-30879100 CCCTGTTCTGCTGTCAGGTTGGG - Intergenic
1172039857 20:32036212-32036234 CCCTGGCTTGTTCCCAGGTGGGG - Intergenic
1172503386 20:35443147-35443169 CCCTGGGCTCCTCTCTGGAGAGG - Intronic
1173706515 20:45114332-45114354 GGCTGGCCTGCTGACAGGTGAGG - Intronic
1174060163 20:47826877-47826899 CCGGGGCCTGCTCCCAGGTGGGG - Intergenic
1174071730 20:47904492-47904514 CCGGGGCCTGCTCCCAGGTGGGG + Intergenic
1174152318 20:48494143-48494165 CCGGGGCCTGCTCCCAGGTGGGG - Intergenic
1174303647 20:49600181-49600203 CCTTGGTCTGCTCTCAGGCAGGG + Intergenic
1174851177 20:53996700-53996722 CCCTGGCCTTGTCTCTGGTTGGG + Intronic
1175305527 20:57973326-57973348 CCTTGGCCTACCCTCAGGTCTGG + Intergenic
1176021972 20:62966686-62966708 CTCTGGCCTCTTCACAGGTGTGG + Exonic
1176146573 20:63568167-63568189 GCCGGGTCTGCTGTCAGGTGAGG - Intronic
1176442944 21:6792644-6792666 CCTTTGCCTGGTATCAGGTGGGG + Intergenic
1176821101 21:13657658-13657680 CCTTTGCCTGGTATCAGGTGGGG + Intergenic
1177176406 21:17704749-17704771 CCCTGGCCAGAACTCAGGGGAGG + Intergenic
1178682908 21:34688358-34688380 CCCTCGCCTGCGCTCTAGTGGGG - Intronic
1178734281 21:35134815-35134837 GCCTGGACTCCTCTCAGCTGTGG - Intronic
1178850008 21:36205223-36205245 CACTCACCTGCTCTCAGTTGTGG + Intronic
1179438148 21:41376027-41376049 CTGTGGCCTGCACTCAGATGAGG - Intronic
1179650873 21:42807776-42807798 CCCAGGCCTGGTTTCAGGTCTGG + Intergenic
1179994496 21:44967713-44967735 CTCAGGCCTGCTGTCGGGTGTGG + Intronic
1180336922 22:11585037-11585059 CCCTGTTCTGCTGTCAGGTTGGG - Intergenic
1180976339 22:19850881-19850903 CCCAGGCCTGCTCCCACGAGGGG - Exonic
1181030225 22:20145945-20145967 CCCTGGCCTGCTCTGGGTGGTGG + Intronic
1181114248 22:20621257-20621279 CCCTCACCTGCTCCCAGGTAAGG - Intergenic
1181391740 22:22588121-22588143 CCCTGCCCTCCTCTGAGGCGGGG + Intergenic
1181918640 22:26301626-26301648 CACTGTCCTCCTCCCAGGTGAGG - Intronic
1182258250 22:29053514-29053536 CCCTTGCCTGGTCCCATGTGTGG + Intronic
1183399227 22:37591782-37591804 CCCAGGCCTGGTTTCAGGTCTGG - Intergenic
1183484487 22:38081883-38081905 CGCTGGGGTGCTCACAGGTGAGG - Exonic
1183661633 22:39224891-39224913 CCCTGGCCAGCTCTGAGGGGAGG - Exonic
1184078084 22:42196343-42196365 CCCAGGCCTGCTCTCTGAAGAGG + Intronic
1184333086 22:43838224-43838246 CCCTGCCCTGCTCTCAAGGAAGG - Intronic
1184453481 22:44596541-44596563 CCCTGGCTTACTAACAGGTGGGG + Intergenic
1184519384 22:44983557-44983579 CCCTCGCCTGCCCTTTGGTGTGG - Intronic
1184890300 22:47375142-47375164 CCGTGGCCTGGTCTCTGGTTGGG - Intergenic
1184989636 22:48158144-48158166 CCCAGGCCTGCTGTCTGGTTTGG + Intergenic
1185026170 22:48414556-48414578 CCCAGTCCTGCCCTCATGTGAGG + Intergenic
1185370779 22:50459935-50459957 CCCTGGCCGGCCCTCACCTGCGG + Exonic
950578516 3:13847340-13847362 CCCTGGCCAGCTCTAGGGAGCGG + Intronic
951709450 3:25573945-25573967 CCCTGCCCTGGCCTGAGGTGGGG - Intronic
951809862 3:26687082-26687104 CCCTGTCCTGTTCTCAGTGGTGG - Intronic
952172637 3:30825759-30825781 CCAGGGCCTGTCCTCAGGTGGGG + Intronic
952526267 3:34213632-34213654 CACCTGCCTGCTCTCAGCTGGGG - Intergenic
952876161 3:37946304-37946326 CCCTGGCCTGCTCTGAACTAAGG - Intronic
954145419 3:48632039-48632061 CCCTGGCCGCCCCACAGGTGGGG - Exonic
954678841 3:52330684-52330706 CCGTGCCCTGTTCTCAGATGAGG + Intronic
956927475 3:74004715-74004737 CCATGGCCTGTTCTCATGTGTGG + Intergenic
957434218 3:80152519-80152541 CCCTGTGTGGCTCTCAGGTGGGG + Intergenic
960949967 3:122992947-122992969 CCCAGGTCTGCTCCCAGGCGTGG - Intronic
961414954 3:126750429-126750451 CCCTGGCCAGACCTCAGATGGGG + Intronic
961439503 3:126944559-126944581 CCCTGGCCTGCTCACCTGAGAGG - Intronic
961820410 3:129572895-129572917 CCCAGGACCACTCTCAGGTGTGG - Exonic
962736438 3:138329603-138329625 CCCTGGCCGGCTCCGGGGTGGGG - Intronic
962917191 3:139915120-139915142 CCCTGGCCTGGCCTCATGTTCGG - Intergenic
964882231 3:161435781-161435803 CCCTGGATTCCTTTCAGGTGGGG + Intergenic
968523499 4:1045122-1045144 CCCTGGCCTGCACTGTGGGGAGG - Intergenic
968745652 4:2358633-2358655 GCCAGGCCTGCTCACTGGTGGGG + Intronic
969346547 4:6574119-6574141 CCCTTGCCTGCACTCAGGGGAGG - Intergenic
969353575 4:6612376-6612398 CCCTGACCTCCTCCCAGCTGTGG - Intronic
969565095 4:7972631-7972653 GCCTGTCCTGCTCTCTGCTGTGG + Intronic
970434889 4:16023706-16023728 ACCTGGACTGCACTCTGGTGGGG + Intronic
970793471 4:19887611-19887633 CTGTGGCCTGCTCTCTGGGGTGG - Intergenic
971829715 4:31674916-31674938 CTCTGCCCTTCTCTGAGGTGGGG - Intergenic
972445164 4:39136707-39136729 TGCTGGGCTGTTCTCAGGTGTGG - Intergenic
974958447 4:68672202-68672224 CTGTGGCCTGCTCTCTGGGGTGG - Intergenic
979649817 4:123115611-123115633 CCCTGGGATCCACTCAGGTGGGG - Intronic
981567193 4:146113929-146113951 CCCTGGTCTGCTCTCGGGGTCGG - Intergenic
981918825 4:150064486-150064508 TCCTGGCCTCTGCTCAGGTGAGG - Intergenic
982525056 4:156467389-156467411 CCGGGGCCTGCCCTCGGGTGGGG - Intergenic
982663049 4:158229107-158229129 CCCAGGCCTGGTTTCAGGTCTGG + Intronic
982934861 4:161460392-161460414 CCCGGGCCTGTTGTGAGGTGGGG - Intronic
984002196 4:174262999-174263021 TCCTGCTCTGCTCTCTGGTGAGG + Exonic
985783119 5:1881203-1881225 CCCTGGGATGCACTCAAGTGGGG + Intronic
985788236 5:1911099-1911121 CCCTGCTGTGCTCCCAGGTGAGG + Intergenic
985863375 5:2492451-2492473 CCTTGGCCCTGTCTCAGGTGTGG - Intergenic
986064712 5:4223824-4223846 CCCTCGCCTGCTTTGAGGAGAGG - Intergenic
986299418 5:6466383-6466405 AGGTGGCCTGCTCTCAGGTGGGG - Intronic
986574700 5:9199486-9199508 CCCTCGCCTGCCCACAGGTCTGG - Intronic
987034415 5:14005862-14005884 CCCTGTCCAGCTCTCAGGTGTGG - Intergenic
987470495 5:18321706-18321728 CCTTGGCCTGCTCTGAGGTATGG + Intergenic
990184694 5:53200765-53200787 CTGTGGCCTGCTCTCTGGGGTGG - Intergenic
991923812 5:71684071-71684093 TCCTGGCCAGATCTCAGGGGAGG + Intergenic
992363714 5:76070084-76070106 ACCTGGGCTGTTCTCAGGTGTGG - Intergenic
992942436 5:81775288-81775310 CCCTGGCCTGGCCTGAGCTGAGG + Intergenic
994116170 5:96063283-96063305 CTGTGGGCTGCCCTCAGGTGGGG - Intergenic
995525731 5:113049335-113049357 GCCAGGCCTGCTCTCAGATAGGG - Intronic
995867717 5:116709281-116709303 CCCAGGCCTGGTTTCAGGTCTGG - Intergenic
997368237 5:133339344-133339366 CACAGGCCTGCTCTCAGGGAGGG + Intronic
997485501 5:134226915-134226937 CCCTGGCCTACTTTCAAGAGGGG + Intergenic
998115108 5:139531194-139531216 CCCAGGCCTGCTTTCAGGCCTGG - Intronic
1002021898 5:176368790-176368812 CCCTGGCCTCTCCTCAGTTGGGG + Exonic
1002047660 5:176550845-176550867 CCGTGGACTGCTCTGAGATGCGG + Intronic
1002261486 5:177996469-177996491 CCCCTGCCTGCTCCCAGGAGGGG - Intergenic
1002785126 6:394089-394111 CCCTGCTCTGCCCACAGGTGGGG - Intronic
1002874953 6:1202495-1202517 CGCTGGCATTCTCCCAGGTGAGG + Intergenic
1005905854 6:30260972-30260994 CCTTGGCCTCCACTCAGGTCAGG + Intergenic
1005922752 6:30416202-30416224 CTCTGGCCTGGTGTCAGGTTGGG + Intergenic
1006570953 6:35003942-35003964 CCCAGGCCTGGTTTCAGGTCTGG - Intronic
1007115833 6:39342793-39342815 CCAAGGCCGGCTCTCAGTTGCGG + Intronic
1007116261 6:39345380-39345402 CCCTGCTCTGCTCTGTGGTGGGG + Intronic
1007429313 6:41767550-41767572 CCCTGGGCTGCCCTCAGGAAAGG - Intergenic
1007595404 6:43048121-43048143 CCCTGCCCTGCTCTGGGGAGAGG - Intronic
1007633190 6:43283908-43283930 CCCTGTCCTGCTCTCTGAGGAGG + Exonic
1008453334 6:51679046-51679068 CCATGCCCTGCTCTGAGCTGTGG + Intronic
1011368791 6:86610067-86610089 CCCAGGCCTGGTTTCAGGTCTGG + Intergenic
1015171514 6:130260235-130260257 CCCAGGCCTGGTTTCAGGTCTGG - Intronic
1016291981 6:142536932-142536954 CTGTGGCCTGCTCTCTGGGGTGG - Intergenic
1016892123 6:149016964-149016986 CCCTGCCCTGCTCACATTTGAGG - Intronic
1018909963 6:168096258-168096280 CCCCTGGCTGCTTTCAGGTGGGG + Intergenic
1019398133 7:834404-834426 CACGGGCCTCCACTCAGGTGAGG - Intronic
1019582068 7:1769636-1769658 CCCTGTCCCGCTCTCAGAAGAGG - Intergenic
1019656320 7:2197979-2198001 CCCAGGCCTGCTCTTAGAGGAGG - Intronic
1022384824 7:29890891-29890913 GCCTGCCCTGTGCTCAGGTGGGG + Intronic
1022384946 7:29891275-29891297 GCCTGCCCTGTGCTCAGGTGTGG + Intronic
1022384965 7:29891339-29891361 GCCTGCCCTGTGCTCAGGTGAGG + Intronic
1022521055 7:31007104-31007126 CCCTTCCCTGTTCTCAGGTGAGG + Intergenic
1024113654 7:46172401-46172423 CCCTGAGCTGCTCCCATGTGAGG - Intergenic
1025234761 7:57227144-57227166 CCGGGGCCTGCTCCCAGGTGGGG + Intergenic
1029203630 7:98855428-98855450 CTGTGGCCTGCTCTTAGGAGAGG - Intronic
1029375928 7:100177028-100177050 TCCCGCCCTGATCTCAGGTGAGG - Exonic
1030083041 7:105793806-105793828 CCCTGGCCTGATCACAGGCAGGG + Intronic
1032018835 7:128395473-128395495 CCCTGTCATGCTCTTAGGGGTGG - Intronic
1032436657 7:131906434-131906456 CCCTGGCCTGGCCTGAAGTGGGG + Intergenic
1032482521 7:132258105-132258127 CCCTGGTCTGCCCTCATGTCGGG + Intronic
1034672291 7:152867968-152867990 CCCTGACGTGCTCTCTGGTCTGG + Intergenic
1035848894 8:2894200-2894222 CCCTGGCTGTCTCTGAGGTGGGG - Intergenic
1040854055 8:51931055-51931077 CCCTGGCCTCATCATAGGTGAGG + Intergenic
1043310829 8:78857388-78857410 ACCACGCCTTCTCTCAGGTGTGG + Intergenic
1043792693 8:84493071-84493093 CCCTGCCCTGCTGACAGGTCTGG + Intronic
1048259913 8:132936733-132936755 CCCCTGCCTCCTCTCCGGTGGGG + Intronic
1048470346 8:134699172-134699194 GTTTGACCTGCTCTCAGGTGTGG - Intronic
1048716966 8:137281754-137281776 CTGTGGCCTGCTCTCTGGGGTGG - Intergenic
1049202003 8:141344922-141344944 CCTGGGCTGGCTCTCAGGTGTGG + Intergenic
1049673026 8:143878123-143878145 CCCTGGCCGCCTCTCCCGTGAGG + Intronic
1049717572 8:144100153-144100175 CCCTGGCATGGACTGAGGTGAGG - Intronic
1049885575 9:24098-24120 GCCTGGCTTGGTCTCAGGTCAGG - Intergenic
1053467395 9:38318900-38318922 CCCTCGTGTGCTCTCAGCTGAGG + Intergenic
1055905876 9:81292767-81292789 TCCTGGCCAGAACTCAGGTGTGG - Intergenic
1056550413 9:87648727-87648749 CCATAGCCTGCTCACAGATGTGG + Intronic
1057067193 9:92066374-92066396 TCTTGACCTGCTCTGAGGTGTGG + Intronic
1057405619 9:94768178-94768200 CCCTGACCTGATCTCTGGGGAGG - Intronic
1057693918 9:97310399-97310421 CCCCCGCCTGCTCTCATCTGAGG - Intronic
1057735779 9:97658426-97658448 CACTGGCTTGCACTGAGGTGCGG - Intronic
1058289000 9:103213873-103213895 CCGGGGCCTGTTTTCAGGTGGGG + Intergenic
1058885037 9:109316549-109316571 CCCTGCCCAACCCTCAGGTGTGG - Intronic
1060235476 9:121859753-121859775 CCGTGGCCTGGACACAGGTGAGG - Intronic
1061008901 9:127943809-127943831 TCCTGGGCTGCTCTCGGGTGGGG - Intronic
1061480692 9:130896466-130896488 CCCCTGCCTGCTCTCAGTGGAGG - Intergenic
1061580791 9:131534611-131534633 CTCTTACCTGCTCTCTGGTGCGG + Intergenic
1061867283 9:133499344-133499366 CCCTGGTCTGGCCTCTGGTGTGG + Intergenic
1062267445 9:135693753-135693775 CAGTGGACTGCTCTCAGCTGGGG + Exonic
1062337323 9:136077736-136077758 CCCTTGCCTGCTCCCCGGTGTGG - Intronic
1062405249 9:136393158-136393180 CCCTGGCCTGCTCTGGGGAGTGG - Intronic
1062446934 9:136599053-136599075 CCCGGGCCTGCCCTCATGTTGGG + Intergenic
1062459077 9:136655354-136655376 CCCTGTCCTGCTCTGGGGGGCGG - Intergenic
1203526259 Un_GL000213v1:91887-91909 CCTTTGCCTGGTATCAGGTGGGG - Intergenic
1203384606 Un_KI270438v1:12220-12242 CTGTGCCCTGCTCTCAGATGTGG - Intergenic
1186558984 X:10590196-10590218 CCCAGGCCTGGTTTCAGGTCTGG + Intronic
1187247187 X:17563372-17563394 CCCTGTTCTGGTCTCAGGTGAGG - Intronic
1187648468 X:21374818-21374840 GCCCGAGCTGCTCTCAGGTGGGG - Intronic
1192361589 X:70444485-70444507 CCCAGGCTTGCTCTGAGCTGGGG - Intergenic
1199595557 X:149503802-149503824 CCCTGGCTAGCTCTCACCTGAGG + Intronic
1199598320 X:149525409-149525431 CCCTGGCTAGCTCTCACCTGAGG - Intronic
1199605908 X:149579573-149579595 CCCTGGGCTCCTCCCAGGAGGGG - Intergenic
1199633213 X:149789795-149789817 CCCTGGGCTCCTCCCAGGAGGGG + Intergenic
1200067999 X:153514204-153514226 CCTTGGCCAGCTCTGAAGTGAGG - Intergenic
1201270027 Y:12245598-12245620 CCCAGGCCTGGTTTCAGGTCTGG - Intergenic
1202367141 Y:24173184-24173206 CCCTGGGCTCCTCCCAGGTCTGG + Intergenic
1202373287 Y:24212489-24212511 CCCTGGGCTCCTCCCAGGTCTGG - Intergenic
1202497495 Y:25457631-25457653 CCCTGGGCTCCTCCCAGGTCTGG + Intergenic
1202503640 Y:25496939-25496961 CCCTGGGCTCCTCCCAGGTCTGG - Intergenic