ID: 1152902396

View in Genome Browser
Species Human (GRCh38)
Location 17:82950400-82950422
Sequence CTGGAAGAGCGGCACTGACG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 95
Summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 87}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152902391_1152902396 6 Left 1152902391 17:82950371-82950393 CCACAAGGAGACGTGGAGTGGGC 0: 1
1: 0
2: 0
3: 9
4: 113
Right 1152902396 17:82950400-82950422 CTGGAAGAGCGGCACTGACGGGG 0: 1
1: 0
2: 1
3: 6
4: 87

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152902396 Original CRISPR CTGGAAGAGCGGCACTGACG GGG Intronic
901146894 1:7070925-7070947 TTGGAAGAGAGGCGCTGACTTGG + Intronic
904023846 1:27489918-27489940 CGGGAAGAGCGGCCCGGCCGGGG + Intronic
905626300 1:39492200-39492222 CATGAAGAGCGGCGCGGACGCGG - Exonic
905670597 1:39788255-39788277 CATGAAGAGCGGCGCGGACGCGG + Exonic
910919290 1:92326663-92326685 CTGGAATAGCTCCACTGACCTGG - Intronic
914921004 1:151847438-151847460 CTGCAAGAGCTGCACTGAGATGG + Intronic
920546867 1:206825634-206825656 CTGGAAGGGCTTCACTGAAGGGG + Intronic
920925767 1:210339925-210339947 CTGGAAGAGGTGCACTGGAGTGG - Intronic
922330571 1:224571762-224571784 CAGGAAGAGGGGCACTGACTGGG + Intronic
922442826 1:225670624-225670646 GTGGAAGAGTGGCAATAACGAGG - Intergenic
922945260 1:229508484-229508506 CTGGAAGCTCGGCACTGCAGCGG - Intergenic
924494681 1:244575580-244575602 CTGGAAGAGTGGCAGTGGCTAGG - Intronic
1063969816 10:11373788-11373810 CTGGAGGAGCAGCAAGGACGGGG - Intergenic
1065048473 10:21765904-21765926 CTGCAAGTGCGGCAGTGACAGGG + Intronic
1069825166 10:71250338-71250360 CTGGGAGAGGGGCAATGATGGGG - Intronic
1072533003 10:96337173-96337195 CTGGAAGAGTGGGACTTATGGGG - Intronic
1077529202 11:3087315-3087337 CACGCAGAGCGGCACTGACACGG + Exonic
1078484474 11:11708771-11708793 GTGGAACAGCGGCACTGACTTGG - Intergenic
1080767433 11:35309781-35309803 CTGGAAGGAAGGCACTGAAGAGG - Intronic
1089924376 11:122242218-122242240 CTGGAAGGGCAGCACTGTCCTGG + Intergenic
1096121172 12:49090321-49090343 CAGGAAGAGCAGCACCGGCGTGG + Exonic
1096847513 12:54415929-54415951 CTTGAAGAGAGGCAGTGACTTGG - Intronic
1102872857 12:116427502-116427524 CTGGGAGGGCGGCAATGACGGGG + Intergenic
1103764171 12:123270011-123270033 CAGGGACAGCGGCACTCACGGGG - Intronic
1112817358 13:103288463-103288485 CTGCAAGAGAGGCACTGTCAAGG - Intergenic
1118843493 14:69529039-69529061 CAGGAAAAGCGGCACTGTGGCGG - Exonic
1131841476 15:96442049-96442071 CTCGAAGAGCGGCACTATGGGGG - Intergenic
1140965022 16:79957641-79957663 CTGGAACAGGGGCACTGAGGGGG - Intergenic
1143053044 17:4142624-4142646 CTGGAAGAGCGGCTGGGCCGCGG - Exonic
1147443778 17:40462722-40462744 CTGGGAGAGTGACACTGATGAGG + Intergenic
1152407174 17:80104499-80104521 CGGGAGGGGCGGCACTCACGGGG - Intergenic
1152902396 17:82950400-82950422 CTGGAAGAGCGGCACTGACGGGG + Intronic
1152902593 17:82952002-82952024 CTGGAAGAGGGGCACTGATGGGG + Intronic
1155446848 18:25921812-25921834 CTTGAAGCCAGGCACTGACGGGG - Intergenic
1159065227 18:63562151-63562173 CTAGAAGATCAGCACTAACGAGG - Intronic
1161861592 19:6801980-6802002 AAGGAAGAGGGGCACTGAGGGGG + Intronic
925208973 2:2031456-2031478 CAGGATGAGAGGCACTGGCGAGG - Intronic
925209000 2:2031584-2031606 CAGGATGAGAGGCACTGGCGAGG - Intronic
925209039 2:2031777-2031799 CAGGATGAGAGGCACTGGCGAGG - Intronic
925209052 2:2031841-2031863 CAGGATGAGAGGCACTGGCGAGG - Intronic
925209062 2:2031906-2031928 CAGGATGAGAGGCACTGGCGAGG - Intronic
925209095 2:2032098-2032120 CAGGATGAGAGGCACTGGCGAGG - Intronic
925209119 2:2032227-2032249 CAGGATGAGAGGCACTGGCGAGG - Intronic
925209157 2:2032420-2032442 CAGGATGAGAGGCACTGGCGAGG - Intronic
925209234 2:2032805-2032827 CAGGATGAGAGGCACTGGCGAGG - Intronic
925209283 2:2033060-2033082 CAGGATGAGAGGCACTGGCGAGG - Intronic
925209326 2:2033259-2033281 CAGGATGAGAGGCACTGGCGAGG - Intronic
925209338 2:2033322-2033344 CAGGATGAGAGGCACTGGCGAGG - Intronic
925209352 2:2033386-2033408 CAGGATGAGAGGCACTGGCGAGG - Intronic
925626564 2:5847253-5847275 CTGGTAGAGGGGCACTCATGAGG + Intergenic
932881631 2:75507474-75507496 CTGGAAGATGGGCACTGAAAGGG - Intronic
934674888 2:96242516-96242538 CTGGAAGAGGGGGAGTGAGGAGG + Intergenic
938236923 2:129712723-129712745 CAAGAAAAGCGGAACTGACGGGG + Intergenic
939189764 2:138902404-138902426 CTGGAAGGGCGAAACAGACGAGG - Intergenic
948176086 2:235944679-235944701 CTGGCAAAGAGACACTGACGTGG - Intronic
948605408 2:239131716-239131738 CTGGCAGGGCGGCACTGGCCTGG - Intronic
1169029605 20:2397245-2397267 CAGGCAGAGCCGCACGGACGTGG + Intronic
1169345133 20:4823263-4823285 CTGGGAGCGAGGCACTGGCGCGG - Intronic
1172357905 20:34292478-34292500 CTGGAAGGGCGAAACGGACGAGG - Exonic
1173243405 20:41317534-41317556 CGGGAAGAGCGGCCCGGTCGCGG - Intronic
1174216293 20:48919240-48919262 CTGGGAGAGCTGCAATGACTGGG + Intergenic
1179955388 21:44735400-44735422 GCGGAAGAGCGGCACTGGCGTGG + Intergenic
949211188 3:1503541-1503563 CTGGAAGAGTGTGAATGACGGGG + Intergenic
950967715 3:17157533-17157555 CTGGAGGAGGGGCACTGGGGAGG - Intronic
952741416 3:36738298-36738320 CTGGAAGAGAGGCACGCAAGGGG - Exonic
954428217 3:50454776-50454798 CTGGAGGAGGGGCACTGCCTGGG + Intronic
954782858 3:53073566-53073588 CTGGAAGAGAGGCGCAGAGGGGG - Intronic
954876179 3:53804521-53804543 CTGGAAGAGAGGAACTCATGCGG - Intronic
955656158 3:61247071-61247093 CTGGTAGGGAGGCACTGATGGGG - Intronic
961563854 3:127749605-127749627 CAGGATGAGAGGCACTGGCGAGG - Intronic
970433579 4:16011465-16011487 CTGACAGAGCGGCACTGGCCCGG + Intronic
1012003489 6:93684191-93684213 CTGAAAGAGAGGCATTGAAGAGG + Intergenic
1018707137 6:166471176-166471198 CTGGAAGAGCGGGGCTGCCCGGG + Intronic
1019135411 6:169904744-169904766 CAGGAAGAGGTGCACTGAGGAGG - Intergenic
1019641851 7:2107496-2107518 CTGGAAGCGCGGCAGTGGCATGG - Intronic
1023826326 7:44012364-44012386 CAGAAATAGCGGCATTGACGTGG + Intergenic
1024059353 7:45686500-45686522 CTGGAAGCTCGGCACTGACTTGG + Intronic
1034935221 7:155194917-155194939 CTGGATGAGAAGCACTGACCTGG - Intergenic
1039550408 8:38439296-38439318 CAGGCAGAGCGGCACAGACCTGG - Intronic
1041245197 8:55882149-55882171 CTGGAAGAGAGGTCCTGATGTGG + Intronic
1041860899 8:62511289-62511311 CATGAAGAGAGGCACTGAAGAGG - Intronic
1043699973 8:83273654-83273676 CTGAAAGAGGAGCACTGAAGTGG - Intergenic
1045233821 8:100331732-100331754 CTGCAGGAGAGGCACTGAAGAGG - Intronic
1047756003 8:127918885-127918907 CTGGAATACCTCCACTGACGGGG + Intergenic
1049664285 8:143836093-143836115 CTGGGAGGGCGGCGCTGCCGTGG - Intronic
1050082250 9:1927725-1927747 CTGACAGGGAGGCACTGACGTGG + Intergenic
1050353267 9:4760367-4760389 CAAGAAGAGCGGCACTGAGTAGG - Intergenic
1053551682 9:39086597-39086619 ATGGAAGAGCAGCACTGAATGGG + Intronic
1053815812 9:41906731-41906753 ATGGAAGAGCAGCACTGAATGGG + Intronic
1054614785 9:67280710-67280732 ATGGAAGAGCAGCACTGAATGGG - Intergenic
1055925914 9:81509678-81509700 CTGGAAGAGCAGCAAAAACGAGG + Intergenic
1187412538 X:19063576-19063598 CTGGAAGAGTGGCCCTGAGCAGG + Intronic
1189214317 X:39310319-39310341 CTGGATGACCGGCACTGTCAGGG + Intergenic
1190452223 X:50593675-50593697 CTGGCAGAGCAGCACTGTCAGGG + Exonic
1198763043 X:140053663-140053685 CTGGAAGAGGTGAACTGACTAGG - Intergenic