ID: 1152904073

View in Genome Browser
Species Human (GRCh38)
Location 17:82960946-82960968
Sequence GAGCCTGACCACAGCCTCTG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 300
Summary {0: 1, 1: 0, 2: 4, 3: 24, 4: 271}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152904066_1152904073 2 Left 1152904066 17:82960921-82960943 CCACCAGACCCTGGGTCTCAAGG 0: 1
1: 0
2: 2
3: 41
4: 286
Right 1152904073 17:82960946-82960968 GAGCCTGACCACAGCCTCTGGGG 0: 1
1: 0
2: 4
3: 24
4: 271
1152904065_1152904073 3 Left 1152904065 17:82960920-82960942 CCCACCAGACCCTGGGTCTCAAG 0: 1
1: 0
2: 0
3: 29
4: 280
Right 1152904073 17:82960946-82960968 GAGCCTGACCACAGCCTCTGGGG 0: 1
1: 0
2: 4
3: 24
4: 271
1152904060_1152904073 11 Left 1152904060 17:82960912-82960934 CCCCGTGTCCCACCAGACCCTGG 0: 1
1: 0
2: 2
3: 17
4: 257
Right 1152904073 17:82960946-82960968 GAGCCTGACCACAGCCTCTGGGG 0: 1
1: 0
2: 4
3: 24
4: 271
1152904062_1152904073 10 Left 1152904062 17:82960913-82960935 CCCGTGTCCCACCAGACCCTGGG 0: 1
1: 0
2: 1
3: 26
4: 344
Right 1152904073 17:82960946-82960968 GAGCCTGACCACAGCCTCTGGGG 0: 1
1: 0
2: 4
3: 24
4: 271
1152904069_1152904073 -6 Left 1152904069 17:82960929-82960951 CCCTGGGTCTCAAGGCAGAGCCT 0: 1
1: 0
2: 1
3: 36
4: 224
Right 1152904073 17:82960946-82960968 GAGCCTGACCACAGCCTCTGGGG 0: 1
1: 0
2: 4
3: 24
4: 271
1152904064_1152904073 9 Left 1152904064 17:82960914-82960936 CCGTGTCCCACCAGACCCTGGGT 0: 1
1: 0
2: 2
3: 28
4: 322
Right 1152904073 17:82960946-82960968 GAGCCTGACCACAGCCTCTGGGG 0: 1
1: 0
2: 4
3: 24
4: 271
1152904059_1152904073 29 Left 1152904059 17:82960894-82960916 CCTCGGGATGTGCTGTTGCCCCG 0: 1
1: 0
2: 0
3: 7
4: 88
Right 1152904073 17:82960946-82960968 GAGCCTGACCACAGCCTCTGGGG 0: 1
1: 0
2: 4
3: 24
4: 271
1152904068_1152904073 -1 Left 1152904068 17:82960924-82960946 CCAGACCCTGGGTCTCAAGGCAG 0: 1
1: 0
2: 3
3: 21
4: 262
Right 1152904073 17:82960946-82960968 GAGCCTGACCACAGCCTCTGGGG 0: 1
1: 0
2: 4
3: 24
4: 271
1152904058_1152904073 30 Left 1152904058 17:82960893-82960915 CCCTCGGGATGTGCTGTTGCCCC 0: 1
1: 0
2: 0
3: 6
4: 76
Right 1152904073 17:82960946-82960968 GAGCCTGACCACAGCCTCTGGGG 0: 1
1: 0
2: 4
3: 24
4: 271
1152904070_1152904073 -7 Left 1152904070 17:82960930-82960952 CCTGGGTCTCAAGGCAGAGCCTG 0: 1
1: 0
2: 1
3: 43
4: 331
Right 1152904073 17:82960946-82960968 GAGCCTGACCACAGCCTCTGGGG 0: 1
1: 0
2: 4
3: 24
4: 271

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152904073 Original CRISPR GAGCCTGACCACAGCCTCTG GGG Intronic