ID: 1152904104

View in Genome Browser
Species Human (GRCh38)
Location 17:82961023-82961045
Sequence TCAGGCGTCCCGGGGCCGGG CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 177
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 161}

Found 14 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152904080_1152904104 26 Left 1152904080 17:82960974-82960996 CCCACCAACCCCGGCCCCGACCT 0: 1
1: 0
2: 3
3: 31
4: 312
Right 1152904104 17:82961023-82961045 TCAGGCGTCCCGGGGCCGGGCGG 0: 1
1: 0
2: 0
3: 15
4: 161
1152904089_1152904104 11 Left 1152904089 17:82960989-82961011 CCCGACCTCGGGCGCCTCCCGTG 0: 1
1: 0
2: 1
3: 8
4: 210
Right 1152904104 17:82961023-82961045 TCAGGCGTCCCGGGGCCGGGCGG 0: 1
1: 0
2: 0
3: 15
4: 161
1152904087_1152904104 16 Left 1152904087 17:82960984-82961006 CCGGCCCCGACCTCGGGCGCCTC 0: 1
1: 0
2: 2
3: 36
4: 282
Right 1152904104 17:82961023-82961045 TCAGGCGTCCCGGGGCCGGGCGG 0: 1
1: 0
2: 0
3: 15
4: 161
1152904088_1152904104 12 Left 1152904088 17:82960988-82961010 CCCCGACCTCGGGCGCCTCCCGT 0: 1
1: 0
2: 1
3: 7
4: 82
Right 1152904104 17:82961023-82961045 TCAGGCGTCCCGGGGCCGGGCGG 0: 1
1: 0
2: 0
3: 15
4: 161
1152904085_1152904104 18 Left 1152904085 17:82960982-82961004 CCCCGGCCCCGACCTCGGGCGCC 0: 1
1: 0
2: 4
3: 47
4: 384
Right 1152904104 17:82961023-82961045 TCAGGCGTCCCGGGGCCGGGCGG 0: 1
1: 0
2: 0
3: 15
4: 161
1152904093_1152904104 -3 Left 1152904093 17:82961003-82961025 CCTCCCGTGTTCCTGGCCTCTCA 0: 1
1: 0
2: 0
3: 23
4: 219
Right 1152904104 17:82961023-82961045 TCAGGCGTCCCGGGGCCGGGCGG 0: 1
1: 0
2: 0
3: 15
4: 161
1152904095_1152904104 -6 Left 1152904095 17:82961006-82961028 CCCGTGTTCCTGGCCTCTCAGGC 0: 1
1: 0
2: 4
3: 36
4: 535
Right 1152904104 17:82961023-82961045 TCAGGCGTCCCGGGGCCGGGCGG 0: 1
1: 0
2: 0
3: 15
4: 161
1152904079_1152904104 27 Left 1152904079 17:82960973-82960995 CCCCACCAACCCCGGCCCCGACC 0: 1
1: 0
2: 6
3: 70
4: 682
Right 1152904104 17:82961023-82961045 TCAGGCGTCCCGGGGCCGGGCGG 0: 1
1: 0
2: 0
3: 15
4: 161
1152904081_1152904104 25 Left 1152904081 17:82960975-82960997 CCACCAACCCCGGCCCCGACCTC 0: 1
1: 1
2: 11
3: 131
4: 1068
Right 1152904104 17:82961023-82961045 TCAGGCGTCCCGGGGCCGGGCGG 0: 1
1: 0
2: 0
3: 15
4: 161
1152904096_1152904104 -7 Left 1152904096 17:82961007-82961029 CCGTGTTCCTGGCCTCTCAGGCG 0: 1
1: 0
2: 4
3: 16
4: 202
Right 1152904104 17:82961023-82961045 TCAGGCGTCCCGGGGCCGGGCGG 0: 1
1: 0
2: 0
3: 15
4: 161
1152904086_1152904104 17 Left 1152904086 17:82960983-82961005 CCCGGCCCCGACCTCGGGCGCCT 0: 1
1: 0
2: 2
3: 22
4: 252
Right 1152904104 17:82961023-82961045 TCAGGCGTCCCGGGGCCGGGCGG 0: 1
1: 0
2: 0
3: 15
4: 161
1152904083_1152904104 22 Left 1152904083 17:82960978-82961000 CCAACCCCGGCCCCGACCTCGGG 0: 1
1: 0
2: 9
3: 53
4: 577
Right 1152904104 17:82961023-82961045 TCAGGCGTCCCGGGGCCGGGCGG 0: 1
1: 0
2: 0
3: 15
4: 161
1152904091_1152904104 6 Left 1152904091 17:82960994-82961016 CCTCGGGCGCCTCCCGTGTTCCT 0: 1
1: 0
2: 0
3: 7
4: 107
Right 1152904104 17:82961023-82961045 TCAGGCGTCCCGGGGCCGGGCGG 0: 1
1: 0
2: 0
3: 15
4: 161
1152904090_1152904104 10 Left 1152904090 17:82960990-82961012 CCGACCTCGGGCGCCTCCCGTGT 0: 1
1: 0
2: 0
3: 4
4: 89
Right 1152904104 17:82961023-82961045 TCAGGCGTCCCGGGGCCGGGCGG 0: 1
1: 0
2: 0
3: 15
4: 161

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152904104 Original CRISPR TCAGGCGTCCCGGGGCCGGG CGG Intronic
901037111 1:6343053-6343075 TCAGGCTTCCCAGGGCGGGCAGG + Intronic
901644482 1:10709219-10709241 CCAGGCCTCCCGGGGCCATGGGG + Intronic
902157712 1:14503047-14503069 TCAGGGGTCCTGGGGCAGGTAGG + Intergenic
902755340 1:18545711-18545733 TCAGGCAGCCTGGGGCCAGGAGG + Intergenic
903121068 1:21217500-21217522 TCAGGTCTGCCGGGGCCGGCAGG - Intronic
903679698 1:25088702-25088724 TCAGCCTTCCCTGGGCTGGGGGG + Intergenic
904062856 1:27725248-27725270 TCAGGCGTCCGGTGGCCTGCAGG - Intergenic
904828237 1:33289421-33289443 TCAGCCGTGCCGAGGCCTGGCGG + Intronic
905202375 1:36323322-36323344 TCCGCCGTCCCGGGGCGGGATGG + Intronic
906640559 1:47438387-47438409 TCTGGCGTCCCGGGGGGCGGCGG + Exonic
912354238 1:109042059-109042081 TGAGGAGTCGCTGGGCCGGGAGG - Intronic
914331668 1:146677277-146677299 TCAGGGGTCGGGGGGCAGGGGGG - Intergenic
921138814 1:212285964-212285986 GGCGGCGTCCCGGGGCCGGAGGG + Exonic
924188264 1:241519417-241519439 AGAGGCGTCCCGAGGCCGGGAGG + Intronic
924495754 1:244586814-244586836 TCAGGGGTCCTGGAGCCAGGTGG + Intronic
1063665065 10:8055936-8055958 TCAGCCGTCCCGGCTCGGGGAGG + Intronic
1070152282 10:73812016-73812038 GCAGGCGACGCGGGGCGGGGAGG - Intergenic
1072731546 10:97850132-97850154 TCAGGTGGGCCGGGGGCGGGCGG - Intergenic
1075517353 10:123119444-123119466 GCAGGGGTCACGGGGCAGGGAGG - Intergenic
1075748434 10:124743990-124744012 GTAAGCGACCCGGGGCCGGGCGG - Intronic
1077053132 11:576631-576653 ACAGGCGGCCCGCGGCCCGGAGG - Intronic
1077142801 11:1031785-1031807 TCAGGTGGGCCGGGGCCCGGGGG - Intronic
1077543599 11:3159247-3159269 TCAGGTGTCCCTGGGGCTGGGGG + Intronic
1081799431 11:45847707-45847729 TGAGGGGACCCGGGGCTGGGTGG + Intronic
1081831874 11:46121433-46121455 TGCTGCGGCCCGGGGCCGGGTGG - Intergenic
1083685661 11:64373510-64373532 CCAGGCCTCCCGGGGACAGGAGG - Intergenic
1083763845 11:64832896-64832918 TCAGGGGGCACGGGGCAGGGTGG + Exonic
1089639495 11:119838400-119838422 TCAGTAGTCCTGGGGCAGGGTGG + Intergenic
1090977918 11:131691765-131691787 GCAGCGGTCCCGGGGCTGGGAGG + Intronic
1091022138 11:132109692-132109714 TGTGGCGTCCCGGAGCCGAGAGG - Intronic
1091558725 12:1594585-1594607 GCGGGCGGCCCGGGGCTGGGAGG - Intronic
1095464106 12:42472701-42472723 TCAGGGGGCCTGGGGCCTGGGGG - Intronic
1096118310 12:49069391-49069413 GCAGGTGTCCTGGGGCGGGGCGG - Intronic
1096184343 12:49568378-49568400 TGAGGCGACCCGGGGAGGGGCGG + Intronic
1096714457 12:53482831-53482853 ACTAGGGTCCCGGGGCCGGGGGG - Exonic
1097167520 12:57093659-57093681 TCTGGTGTCCTGGGGCCAGGTGG + Intronic
1097246622 12:57610960-57610982 GCTGGAGTCCCGGGGCCTGGAGG + Intronic
1097990235 12:65825541-65825563 GCTGGCGCCCCGGGGCCGCGCGG - Intronic
1103852399 12:123941664-123941686 GCAGGCGTGCCGGGGCAAGGCGG - Intronic
1104727068 12:131084678-131084700 TCAGGGGTCGCGGGACCTGGGGG + Intronic
1106476763 13:30105601-30105623 CCAGGCCTCCCGGGCCCTGGAGG - Intergenic
1112504895 13:99969731-99969753 CCAGACTTCCCAGGGCCGGGCGG + Intronic
1113841524 13:113364100-113364122 TTAAGCGCCCCGGAGCCGGGAGG - Exonic
1115769429 14:36655134-36655156 CCAGGAGTCCCGCGGCCGAGCGG - Intergenic
1118745286 14:68768827-68768849 TCAGGTGTCCAGTGGCGGGGGGG - Intergenic
1119522137 14:75294269-75294291 GCCGGCGTCACGGCGCCGGGTGG - Intergenic
1119780030 14:77271200-77271222 CCAGGCGTCGCGGGGTGGGGCGG - Exonic
1121426915 14:93858996-93859018 CCAGGGGTCCCGGCGCTGGGAGG + Intergenic
1121774452 14:96581522-96581544 TCAGAGGTCCCCGGGGCGGGTGG - Intergenic
1122836675 14:104434062-104434084 TCAGGCGCCCCGGAGCTGGAGGG + Intergenic
1122941990 14:104985654-104985676 GGAGGCGGCCCGGGGCAGGGAGG + Intergenic
1125742218 15:41973005-41973027 TCTGTCTTCCCGGGGGCGGGTGG + Intergenic
1132056032 15:98650352-98650374 CCCGGCGTCCCGGGGCTGGGCGG + Intronic
1132154174 15:99484095-99484117 TCAGCCTTCATGGGGCCGGGGGG - Intergenic
1132552921 16:560694-560716 TTGGGCGTCGCGGGGCCGGCTGG + Intronic
1132856645 16:2047991-2048013 GGCGGCGTCCCGGGGCCAGGGGG + Exonic
1133053704 16:3134350-3134372 TCAGGGGTCCCACGGCCCGGAGG - Intronic
1133241337 16:4416191-4416213 TCGGGGGTCCCGGGGCGAGGTGG + Intronic
1137247951 16:46720781-46720803 CCAGGCATCCTGGGGCCAGGAGG - Intronic
1138641704 16:58392840-58392862 TGCGGCGTCCCAGGGCCGAGGGG - Intronic
1138889837 16:61128827-61128849 TCAGGCGTGCGGGAGCCGGTGGG + Intergenic
1139684295 16:68590717-68590739 GCAGGCTTCCTGCGGCCGGGCGG - Intergenic
1140001885 16:71033626-71033648 TCAGGGGTCGGGGGGCAGGGGGG + Intronic
1140519095 16:75566585-75566607 TCGGGCGGCCCTGGGCCGAGTGG + Intronic
1142009176 16:87705058-87705080 TCAGGGGTCTGGGGGCCGTGTGG + Intronic
1142403588 16:89873801-89873823 TCCGGCGTCCCGGGGGCGCAGGG + Exonic
1142753445 17:2001883-2001905 TCAGGGGAGCCGGGGACGGGGGG - Intronic
1144586802 17:16492115-16492137 GCGGGCGTCGCGGGGGCGGGCGG + Intronic
1144717014 17:17442626-17442648 CCAGCCGTCCCGGTACCGGGAGG - Intergenic
1146371085 17:32265989-32266011 CCGGGCGTCCCGGGGTCGCGAGG + Intergenic
1147150254 17:38510162-38510184 TGAGGCGTCCGGGGGCCTCGGGG - Exonic
1147331049 17:39699855-39699877 CCAGGCGTCCCGGCGCTAGGAGG + Intronic
1147360668 17:39927630-39927652 TCGGGCGTGCCGGCGCGGGGCGG - Intergenic
1147969215 17:44210696-44210718 TCAGGCGGCCAGGGGCGAGGTGG + Intronic
1147987598 17:44315369-44315391 CCGGGCATCCCGGGGCGGGGCGG + Intronic
1148750279 17:49941575-49941597 TCAGGTGTCCCGGGAGAGGGAGG - Intergenic
1152904104 17:82961023-82961045 TCAGGCGTCCCGGGGCCGGGCGG + Intronic
1153226743 18:2906111-2906133 TCAGGCGTCCCGTGGACGGTCGG + Intronic
1153265202 18:3262449-3262471 CCGGACGTCCAGGGGCCGGGAGG + Exonic
1154012673 18:10589199-10589221 CCAGGTGGCCCCGGGCCGGGAGG + Intergenic
1155565619 18:27131221-27131243 TCTGGGGTCCCTGGGCCAGGAGG - Intronic
1158564796 18:58545593-58545615 TCAGAAGCCCCGGGGCCAGGAGG + Intronic
1160826550 19:1082926-1082948 GGCGGCGTCCCGGGGCCGGCAGG + Exonic
1160846559 19:1168621-1168643 TCCGGTGCCCAGGGGCCGGGTGG - Intronic
1160952756 19:1675513-1675535 CCAGGCGTCCCGCGGCAGGTCGG + Intergenic
1161153532 19:2721281-2721303 GTAGGCGGCCCGGGGCGGGGAGG - Intronic
1161560343 19:4969411-4969433 GCGGGCGCCCCCGGGCCGGGCGG - Intronic
1162100466 19:8335622-8335644 TCGGGGGTCCCGGGGCGCGGCGG + Exonic
1162370205 19:10274119-10274141 ACAGATGTCCCGGGGCAGGGTGG - Intronic
1162372047 19:10285384-10285406 TCCGGCGTCCCAGGGCCGGTAGG - Exonic
1162591924 19:11597645-11597667 TCAGGCGTCCCCAGACCTGGGGG + Intronic
1162597361 19:11639743-11639765 TCAGGCGTCCAGGAGGCTGGAGG + Intergenic
1162914138 19:13865357-13865379 GCAGGCGCCTCGGGCCCGGGGGG + Intronic
1163102970 19:15108776-15108798 TCAGGCTTCCTGGGGCCCGTAGG - Intronic
1164179409 19:22806598-22806620 TGAAGCTTCCCGGGGCCGGGAGG - Intergenic
1166502864 19:43354149-43354171 TCAGGCCTCCAGGGTCCTGGAGG - Intronic
1167009856 19:46800313-46800335 TTAGGAGTCCAGGGGCCTGGGGG - Intergenic
1167019085 19:46861071-46861093 TCCGGCGGCGGGGGGCCGGGCGG - Intergenic
1167289133 19:48614972-48614994 TCAGGCTTCCCGGTCCCCGGGGG + Intergenic
1168536021 19:57171908-57171930 AAATGCGTCCCCGGGCCGGGGGG + Intergenic
925309793 2:2874484-2874506 TCAGGAGCCCCAGGGCCTGGAGG - Intergenic
931762668 2:65431591-65431613 TCCGGCTTCCCGGGGCTGGTGGG - Intronic
932469442 2:71944373-71944395 TCAGGCCTCCCGGGGGCGCTGGG - Intergenic
932699642 2:73984473-73984495 TCAGGCCTCCCGGGGGCGCCGGG + Intergenic
933751103 2:85602531-85602553 TCTCGCGTCCCGGGTCCTGGGGG - Intronic
945033705 2:205686561-205686583 GCAGGCGTCCAGCGGCTGGGTGG + Intronic
946404090 2:219483616-219483638 CCAGGCCTCCCCGGGCCAGGCGG - Exonic
949059645 2:241949479-241949501 TGAGCCCTCCCTGGGCCGGGTGG + Intergenic
1169382394 20:5119550-5119572 GCCGGCTTCCCGGGGCCGCGAGG + Intronic
1175304662 20:57967609-57967631 TCTGGCTGCCCGGGGTCGGGGGG - Intergenic
1175599831 20:60264248-60264270 TCTGGCCTCCCAGGCCCGGGAGG + Intergenic
1176062562 20:63178779-63178801 TCTGGCGTCGCGGGGCGGGTGGG + Intergenic
1176085055 20:63292136-63292158 TCAGGCAACCCAGGGTCGGGAGG + Intergenic
1178950350 21:36980684-36980706 TCAGCGGTCCCGGAGCCTGGCGG - Intronic
1179796802 21:43789692-43789714 GCAGGTGACCCGGGACCGGGCGG + Exonic
1180072042 21:45441459-45441481 TCAAGCGTCCCGAGGCCTGGAGG - Intronic
1180612769 22:17108584-17108606 GCAGGCGCTCCTGGGCCGGGGGG + Exonic
1180748847 22:18110870-18110892 TGAGGCTTCCCGGGGCCAGGCGG + Intronic
1180942059 22:19666013-19666035 TCATGCTTCCAGGGTCCGGGAGG - Intergenic
1181785286 22:25222208-25222230 TCAGGCTTCCCTGGCCCAGGAGG - Intronic
1182445533 22:30387347-30387369 CCAGGGGTCCCGGGCGCGGGGGG + Exonic
1183481960 22:38070114-38070136 TCAGGCCTCTCTGGGCAGGGAGG - Intronic
1183536118 22:38402398-38402420 TCAGGGGCCCCGGGGCCAGGGGG - Intergenic
1183613512 22:38927304-38927326 TCAGGCTGCCGGGGGCGGGGGGG + Intergenic
1183966710 22:41446721-41446743 TCGGGCGACGCGGGGCCAGGAGG - Exonic
1184551679 22:45207818-45207840 ACAGACGTCCCCGGGTCGGGGGG + Intronic
1184766986 22:46577211-46577233 GCAGGCGTAGCGCGGCCGGGCGG + Intronic
950710610 3:14810713-14810735 CGAGGCGCGCCGGGGCCGGGCGG + Intergenic
954584003 3:51718816-51718838 CCAGGCATCCTGGGGTCGGGTGG + Intergenic
955023887 3:55148401-55148423 CCAGGCATCCCGGAGCCTGGCGG + Intergenic
956798804 3:72738894-72738916 TCGGGCGTCGCGGGGCGGGGCGG - Intergenic
961827577 3:129606873-129606895 GCGGGGGTCCCGGGGGCGGGCGG - Intergenic
962793838 3:138834435-138834457 TCTGCCGCCCAGGGGCCGGGGGG + Intronic
967880383 3:194297327-194297349 TGGAGCGGCCCGGGGCCGGGTGG - Intergenic
968133669 3:196207580-196207602 GCGGGCGTCCGGGGGCGGGGCGG - Intronic
968133716 3:196207677-196207699 GCGGGCGTCCGGGGGCGGGGCGG - Intronic
968433828 4:575210-575232 TCGGGCGCGCCGGGGCCGGCGGG - Intergenic
968466167 4:752532-752554 TGAGGCCTCCGGGGACCGGGCGG + Intronic
968483766 4:849023-849045 AGAGGAGTCCCGGGGCCGAGGGG + Intergenic
968879588 4:3292389-3292411 GCGGGCGTCCCGGGGCCCGGAGG + Intergenic
969706243 4:8793883-8793905 GCAGGCTTCCCAGGGCTGGGTGG + Intergenic
972437086 4:39044887-39044909 TCAGGCGGCGCCAGGCCGGGGGG - Intergenic
974069454 4:57110492-57110514 GCAGGCCCCGCGGGGCCGGGAGG - Intergenic
982202670 4:152975097-152975119 TCAGGCCTCGGGGGGCCAGGAGG + Exonic
984639259 4:182144524-182144546 TCCCGCGTCCCCGGGCCGCGCGG + Intronic
984956894 4:185053812-185053834 TCAGGTCTCCCGGGTCCTGGAGG - Intergenic
985510147 5:308930-308952 TCAGCTGTCCCGGTGCCGGGTGG - Intronic
985549993 5:528205-528227 TCAGGGGCCCCGGGGTTGGGTGG + Intergenic
985550007 5:528233-528255 TCAGGGGCCCCGGGGTTGGGTGG + Intergenic
985580579 5:693499-693521 CCGCGCGTCCCCGGGCCGGGTGG - Intergenic
988684921 5:33516885-33516907 TCATGAGTCCAGGGTCCGGGTGG - Intergenic
990984153 5:61626254-61626276 TCGGGGGTTCCTGGGCCGGGTGG + Intergenic
999260993 5:150238928-150238950 GCAGGTGGCCAGGGGCCGGGTGG + Intronic
1001563910 5:172687337-172687359 CCAGGGGTCCCGGCTCCGGGAGG + Exonic
1002524264 5:179806710-179806732 GCGGGGGGCCCGGGGCCGGGCGG + Intronic
1009392623 6:63163433-63163455 TCAGGGGAGCCGGGGCAGGGAGG - Intergenic
1016744610 6:147565299-147565321 TCAGGCCTGTGGGGGCCGGGAGG + Exonic
1018458096 6:163971048-163971070 TCAGGCGTGTAGGGGCCAGGGGG - Intergenic
1019337993 7:494242-494264 TCCGGCGCCCCGGGGGCGGGCGG - Intergenic
1019506866 7:1395792-1395814 CCAGGCGTCACGTGGCCAGGGGG + Intergenic
1020130134 7:5555113-5555135 TCCCGCGTCCCAGGGCCGCGAGG + Intronic
1021959602 7:25858666-25858688 TGAGGCTTCCCGGGGCAGGAGGG + Intergenic
1022163947 7:27740024-27740046 TGAGGCGTCCCGCGGCGGAGTGG + Intronic
1022814810 7:33904457-33904479 TCGGGCGGACCGGGGCGGGGAGG - Intergenic
1028593927 7:92528280-92528302 TCAGGTGGCTCGGGGCCGGCAGG + Intronic
1037620886 8:20562465-20562487 TCATGAGCCACGGGGCCGGGCGG - Intergenic
1045320863 8:101080572-101080594 AAGGGCGTCCCGGGGCGGGGGGG + Intergenic
1052982348 9:34458381-34458403 TCGGGCGGGCAGGGGCCGGGCGG + Exonic
1057228885 9:93306889-93306911 TCAGGGTTCCCGCGGCCGGGCGG + Intronic
1058618929 9:106863330-106863352 AGAAGCGTCCCGGCGCCGGGAGG - Exonic
1059176648 9:112174903-112174925 CCCGGCGTCGCGGGGTCGGGCGG + Intronic
1060629450 9:125143130-125143152 GCTGGCGGCGCGGGGCCGGGAGG - Intronic
1062341456 9:136095428-136095450 GCTGGGGTCCGGGGGCCGGGAGG + Intergenic
1062383981 9:136301401-136301423 TGAAGGGTCCCGGGGCTGGGAGG + Intronic
1203760487 EBV:10697-10719 TCAAGCGTCCGGGAGCCGGGCGG + Intergenic
1192584115 X:72306626-72306648 CCAGGCGCCCCGGGGTCGGGTGG - Intronic
1195234574 X:102883887-102883909 TCACACTTCCCGGGGCCAGGAGG - Intergenic