ID: 1152904176

View in Genome Browser
Species Human (GRCh38)
Location 17:82961370-82961392
Sequence TTCTCCACAGGCGGGAAAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 167
Summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 149}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152904170_1152904176 2 Left 1152904170 17:82961345-82961367 CCACAACAGACGTGAGCAACCGA 0: 1
1: 0
2: 0
3: 5
4: 40
Right 1152904176 17:82961370-82961392 TTCTCCACAGGCGGGAAAGAGGG 0: 1
1: 0
2: 1
3: 16
4: 149

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152904176 Original CRISPR TTCTCCACAGGCGGGAAAGA GGG Intronic