ID: 1152915577

View in Genome Browser
Species Human (GRCh38)
Location 17:83033029-83033051
Sequence AGCGGCCTGGAGACGCTGAG CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 208
Summary {0: 1, 1: 0, 2: 2, 3: 20, 4: 185}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152915566_1152915577 16 Left 1152915566 17:83032990-83033012 CCCGCGTAAATCCCCGCGTAGGC 0: 1
1: 0
2: 0
3: 0
4: 2
Right 1152915577 17:83033029-83033051 AGCGGCCTGGAGACGCTGAGCGG 0: 1
1: 0
2: 2
3: 20
4: 185
1152915573_1152915577 3 Left 1152915573 17:83033003-83033025 CCGCGTAGGCAGGAGCTCTGGGC 0: 1
1: 0
2: 0
3: 19
4: 184
Right 1152915577 17:83033029-83033051 AGCGGCCTGGAGACGCTGAGCGG 0: 1
1: 0
2: 2
3: 20
4: 185
1152915567_1152915577 15 Left 1152915567 17:83032991-83033013 CCGCGTAAATCCCCGCGTAGGCA 0: 1
1: 0
2: 0
3: 0
4: 11
Right 1152915577 17:83033029-83033051 AGCGGCCTGGAGACGCTGAGCGG 0: 1
1: 0
2: 2
3: 20
4: 185
1152915569_1152915577 5 Left 1152915569 17:83033001-83033023 CCCCGCGTAGGCAGGAGCTCTGG 0: 1
1: 0
2: 0
3: 4
4: 96
Right 1152915577 17:83033029-83033051 AGCGGCCTGGAGACGCTGAGCGG 0: 1
1: 0
2: 2
3: 20
4: 185
1152915571_1152915577 4 Left 1152915571 17:83033002-83033024 CCCGCGTAGGCAGGAGCTCTGGG 0: 1
1: 0
2: 1
3: 17
4: 173
Right 1152915577 17:83033029-83033051 AGCGGCCTGGAGACGCTGAGCGG 0: 1
1: 0
2: 2
3: 20
4: 185

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152915577 Original CRISPR AGCGGCCTGGAGACGCTGAG CGG Intronic