ID: 1152917872

View in Genome Browser
Species Human (GRCh38)
Location 17:83051437-83051459
Sequence CTTCAAAATCAGAACGAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 190
Summary {0: 1, 1: 0, 2: 0, 3: 18, 4: 171}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152917860_1152917872 30 Left 1152917860 17:83051384-83051406 CCCACGACCAGGTGAGGGCGAAC 0: 1
1: 0
2: 0
3: 2
4: 38
Right 1152917872 17:83051437-83051459 CTTCAAAATCAGAACGAGGAAGG 0: 1
1: 0
2: 0
3: 18
4: 171
1152917865_1152917872 23 Left 1152917865 17:83051391-83051413 CCAGGTGAGGGCGAACGGGGAAC 0: 1
1: 0
2: 0
3: 2
4: 52
Right 1152917872 17:83051437-83051459 CTTCAAAATCAGAACGAGGAAGG 0: 1
1: 0
2: 0
3: 18
4: 171
1152917868_1152917872 -10 Left 1152917868 17:83051424-83051446 CCGAGCCCGGAAGCTTCAAAATC 0: 1
1: 0
2: 1
3: 12
4: 136
Right 1152917872 17:83051437-83051459 CTTCAAAATCAGAACGAGGAAGG 0: 1
1: 0
2: 0
3: 18
4: 171
1152917861_1152917872 29 Left 1152917861 17:83051385-83051407 CCACGACCAGGTGAGGGCGAACG 0: 1
1: 0
2: 0
3: 2
4: 26
Right 1152917872 17:83051437-83051459 CTTCAAAATCAGAACGAGGAAGG 0: 1
1: 0
2: 0
3: 18
4: 171
1152917867_1152917872 -2 Left 1152917867 17:83051416-83051438 CCTGAGCTCCGAGCCCGGAAGCT 0: 1
1: 0
2: 0
3: 6
4: 92
Right 1152917872 17:83051437-83051459 CTTCAAAATCAGAACGAGGAAGG 0: 1
1: 0
2: 0
3: 18
4: 171

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152917872 Original CRISPR CTTCAAAATCAGAACGAGGA AGG Intronic
901517558 1:9759171-9759193 CTTCAAAATCAGGAACAGGTTGG - Intronic
903020992 1:20394179-20394201 CTACAAAAGGAGAAAGAGGATGG + Intergenic
903756530 1:25665724-25665746 TTTCAAAATCAGCAGGATGATGG - Intronic
905403126 1:37717235-37717257 CTTCAAAGTCAGAGCAGGGAGGG + Exonic
906257694 1:44363008-44363030 CTGCCAAATCAGGACCAGGAAGG - Intergenic
906315839 1:44786022-44786044 CTTTAAAATTAGAGGGAGGAGGG + Intronic
906434717 1:45785666-45785688 CTACAAAACCTGAACGAGGGTGG - Intergenic
907996255 1:59635891-59635913 CTTCAGAATCACAAGGAGAAGGG + Intronic
912524090 1:110267877-110267899 CTTCAATCTCTGAACAAGGAAGG - Intronic
912531526 1:110327345-110327367 CTTTAAAAACAAAACAAGGAAGG + Intergenic
912886812 1:113483515-113483537 CTTTAAAATCAGTACCAGCATGG - Intronic
921551921 1:216547331-216547353 CTTCAAAAACTGCATGAGGAAGG - Intronic
922408335 1:225342375-225342397 AATCAAAATCAGAAAGTGGAAGG + Intronic
922593108 1:226793505-226793527 CTTTAAAAACAGAAAGAGGCCGG + Intergenic
923388185 1:233486680-233486702 CTTGAAAATCAGAAGGAAGATGG - Intergenic
924202738 1:241676496-241676518 CCTCAAAAACAGAACTAAGATGG + Intronic
924228146 1:241939918-241939940 CCTCATAATCAGAACCAGAAGGG - Intergenic
1063131644 10:3183155-3183177 CTTTTAAATCAGAATTAGGAGGG + Intergenic
1064557660 10:16563530-16563552 CTGCAAAACTAGAAGGAGGAGGG + Intergenic
1065085977 10:22176954-22176976 CTGCAAAATCAGAAAGAATATGG + Intergenic
1069212679 10:65780604-65780626 CTACAAAATCAGAACGGCCAGGG - Intergenic
1070322915 10:75367886-75367908 TTTCAGAATCAGAGCCAGGAAGG - Intergenic
1074128074 10:110546190-110546212 CTCCAGAATCAGAACAAGGCTGG + Intergenic
1077645245 11:3917728-3917750 CTTCAAAAACAAAACAAGGCTGG - Intronic
1081170320 11:39861014-39861036 CTTCAAAATCAGCATTAGAAAGG + Intergenic
1083150615 11:60789663-60789685 CTGCAAAATGAGAGTGAGGACGG + Intronic
1087154872 11:94891717-94891739 CATCAAAATCAGTACTAAGAGGG - Intergenic
1091446739 12:548058-548080 CTGCACAAGCAGAATGAGGAGGG + Exonic
1092809092 12:12255436-12255458 CTTCAAAATCAAACCGAAAAAGG - Intronic
1093583596 12:20810708-20810730 CTTTAACATCAGAAAAAGGATGG + Intronic
1097634576 12:62106990-62107012 TTCCAAAAGCAGAACGAGAAAGG + Intronic
1098444859 12:70556059-70556081 CATCAAAGTCAGAATCAGGAGGG + Exonic
1101083644 12:101213786-101213808 CCTCACAATCAGAAGGAGAACGG - Intergenic
1101258893 12:103008958-103008980 CATCAATATGAGAAGGAGGAAGG + Intergenic
1101988122 12:109463164-109463186 CATCAAAGGCAGAACGTGGAAGG - Intronic
1103280687 12:119755820-119755842 CTTCAAAAACATAAGGAGGCTGG - Intronic
1106920249 13:34555698-34555720 ATTCAAAAGCAGACCCAGGAAGG + Intergenic
1108149432 13:47517187-47517209 GTTCAAAGTCAGAAAGAGAAGGG + Intergenic
1109239793 13:59871732-59871754 CTTCAAAAACAGAAAGAACAAGG - Intronic
1112343455 13:98571335-98571357 CATCAAAGTCAGAAAGAGGGTGG + Intronic
1120551106 14:85874114-85874136 TTTCAAAATGAGAAAGAAGAAGG + Intergenic
1120867316 14:89306726-89306748 CTACAAAGTCAGAACTAGGACGG + Intronic
1125990868 15:44106523-44106545 TTTAAAAATCAGAATGAGGCAGG - Intronic
1126716483 15:51523741-51523763 CTTGAATATCAGAAAGAGCATGG + Intronic
1126752442 15:51890784-51890806 CTTAAAAATGAGAAGGGGGATGG - Intronic
1127505403 15:59593202-59593224 CTACAAAACCAGAACAAAGAGGG + Intergenic
1129798803 15:78397909-78397931 CTTCAAAATCAGACTGGGAAAGG + Intergenic
1131302929 15:91215349-91215371 CTGCTAAAACAGAAGGAGGAGGG - Intronic
1131922707 15:97347380-97347402 CTTCAAAATCAGATTGAGACTGG - Intergenic
1133602087 16:7349593-7349615 CCTCAGAATCAAAATGAGGATGG + Intronic
1133620844 16:7524825-7524847 CTTCAAAATCAGAACTGGCATGG - Intronic
1134170658 16:11966499-11966521 TGTCAAAATCAGAATGAAGATGG - Intronic
1134825187 16:17278818-17278840 CTTCAGAATCAGACCTAGGATGG - Intronic
1137300981 16:47147103-47147125 CTTCAACATATGAACTAGGAGGG - Intergenic
1137757437 16:50913864-50913886 CTTTAAAATGAGAAGGTGGAGGG + Intergenic
1137759092 16:50926201-50926223 CTTCAAATTCATAATGAGTATGG - Intergenic
1138045000 16:53712606-53712628 TTTCAAAACCAGTACTAGGAGGG - Intronic
1138364490 16:56462980-56463002 CTTCAAAATAAAAAAGAGAAGGG - Intronic
1138572769 16:57886221-57886243 CTTCCAAATCAGAACAACCAGGG - Intronic
1139848829 16:69938749-69938771 CTCTAAAAGCAGAACGTGGATGG + Intronic
1141845638 16:86606846-86606868 CTTCACAATCATAACGTTGAGGG - Intergenic
1141867696 16:86762059-86762081 ATGGAAAATCAGAATGAGGAAGG + Intergenic
1145093102 17:20001951-20001973 CTTGAAAATAAGAAAGAGGCCGG - Intergenic
1147411887 17:40259176-40259198 CCTAAAAATCAGCACGAGGCCGG - Intronic
1150927030 17:69543317-69543339 CTTCAAAATCTAAAAGGGGAAGG - Exonic
1151333448 17:73424922-73424944 TTTCAAAAGCAGAACCAGGCTGG + Intronic
1152493117 17:80651198-80651220 CTTCTAAGTCAGAAAGTGGAAGG + Intronic
1152917872 17:83051437-83051459 CTTCAAAATCAGAACGAGGAAGG + Intronic
1154955087 18:21245649-21245671 CTGCAAAATCAAAAACAGGAAGG - Intronic
1156435222 18:37119663-37119685 CTTCAATATATGAATGAGGATGG + Intronic
1157175276 18:45446238-45446260 CTTCAACATATGAATGAGGAGGG - Intronic
1159325691 18:66913710-66913732 TTTCAAAATCAGAGGCAGGAAGG + Intergenic
1166656026 19:44612685-44612707 CTTGAATATCAGATCCAGGAGGG - Intergenic
924959421 2:20299-20321 TTTCACAGTCAGCACGAGGATGG - Intergenic
925645595 2:6032701-6032723 TTACAAAATCAGAAACAGGAGGG + Intergenic
925899555 2:8498868-8498890 CTGCAAAATGAGGATGAGGATGG + Intergenic
925900605 2:8506638-8506660 CTACAAAATCAGAGAGAAGAAGG + Intergenic
925905218 2:8536141-8536163 CTGAAAAATTAGAACCAGGAGGG - Intergenic
926835190 2:17011435-17011457 GTTCAAAATTAGAATGAGGTGGG - Intergenic
928703067 2:33918672-33918694 CTTCAAAATAATAATGAGGGGGG + Intergenic
929445852 2:42000647-42000669 CTGCTAAAGCAGAACCAGGAAGG + Intergenic
929917162 2:46145570-46145592 CTTTAAAATCAGAACAGGGTGGG + Intronic
931953246 2:67389025-67389047 CTTCTAAATCATCAAGAGGAAGG - Intergenic
937530876 2:122825576-122825598 CTACAAAATTAGAATGAGGATGG - Intergenic
937799811 2:126070444-126070466 CTTCACATTGAGAAGGAGGAAGG - Intergenic
938713393 2:133995318-133995340 CTTCAAAATCACAATGAGGTAGG + Intergenic
939303021 2:140371579-140371601 CTTCAAAATCAAAGGGATGAAGG - Intronic
942166581 2:173246619-173246641 ATTCAAAAGCAGAATTAGGAAGG + Intronic
945496640 2:210515233-210515255 CTCCAAAAACAGAAAGAGGAAGG - Intronic
1170064480 20:12295656-12295678 GTTCAAGGTCAGAACTAGGATGG + Intergenic
1172138976 20:32708445-32708467 CTCCAAAATCAGACTGAGCAAGG + Intronic
1173011009 20:39182096-39182118 CTTCAAAATCGAAATGAGAAAGG + Intergenic
1174468538 20:50737071-50737093 CTTCAGAATCAGAACTGTGAAGG + Intronic
1177235006 21:18377388-18377410 CATCAAACTCAGAAGGGGGAAGG + Intronic
1180253576 21:46606378-46606400 CTCCAACATCTGAGCGAGGAAGG - Intergenic
1182640077 22:31759977-31759999 CTTTAAAACCAGAAAGAGGCTGG - Intronic
950675998 3:14554814-14554836 CTGCACAATCAGAATGAGGATGG + Intergenic
958765209 3:98360020-98360042 CTTCAAATTCAGAACTGAGAGGG - Intergenic
960442998 3:117711947-117711969 CTTAAAAGTCAGAAAGAGGTAGG - Intergenic
960556178 3:119033572-119033594 CTTCAAAATCAGTTCGAATAAGG + Intronic
961945814 3:130686399-130686421 ATTCTAGATCAGAAGGAGGACGG - Exonic
963366083 3:144336432-144336454 CTTAAAAATTAGAAAGAGGCTGG + Intergenic
963836775 3:150066034-150066056 CTTTGAAATCAGACCAAGGATGG - Intergenic
964628235 3:158779832-158779854 CTTTAAAATCAAAAAGAGGCCGG - Intronic
965168989 3:165236408-165236430 CTTCAAAAACAGCAAGAGAAGGG - Intergenic
966195071 3:177304953-177304975 CTTAAAGATCAGAAGGAGGCCGG - Intergenic
967270250 3:187726921-187726943 CACCAAAGTCAGCACGAGGAAGG + Intronic
967393408 3:188979742-188979764 ATTCATAATCAGAGGGAGGAGGG - Intronic
970970576 4:21978921-21978943 CTTAAAAATCTGAAAGAGGAAGG - Intergenic
971745277 4:30572002-30572024 CTTCAAGGTCAGAACAGGGATGG - Intergenic
973370247 4:49240206-49240228 CTGGAAAATAAGAACGGGGAGGG - Intergenic
973390782 4:49555214-49555236 CTGGAAAATAAGAACGGGGAGGG + Intergenic
974499116 4:62675322-62675344 CTTCAAAAACTTAAGGAGGATGG - Intergenic
975157023 4:71083477-71083499 CTTAATAATCAGAATCAGGAAGG - Intergenic
976871498 4:89799488-89799510 ATACAACATTAGAACGAGGATGG + Intronic
978218386 4:106237405-106237427 CTTCAAAATCATAAGCAGGAAGG + Intronic
983711281 4:170719929-170719951 CTTCCAAATCAGAAAGTGGGAGG + Intergenic
988226198 5:28414031-28414053 TTTCAAGATGAGAACAAGGAGGG - Intergenic
988542691 5:32126013-32126035 TTTTAAAAACAGAAAGAGGAAGG + Exonic
988672416 5:33396212-33396234 CTCCAAATTCAGCACGAGCAAGG + Intergenic
989609015 5:43273662-43273684 CTGGAAAAGCAGAATGAGGAGGG - Intronic
989715006 5:44452782-44452804 GTTCAAATTCAGAATGAGAAAGG + Intergenic
990334823 5:54762203-54762225 TTTCAAAATCAGAATGAACATGG + Intergenic
991513856 5:67412070-67412092 CTTGAAACTCAGAATGAAGATGG + Intergenic
992588708 5:78270854-78270876 CTACAGAATCAAAAGGAGGAGGG - Intronic
992588873 5:78272463-78272485 CTTCAGAATCTAAAGGAGGAGGG - Intronic
994695335 5:103066707-103066729 CTTCAATCTCTGAACAAGGAAGG + Intergenic
995149003 5:108820428-108820450 CTTCAAAAGAAGAACAAGAAAGG + Intronic
995321348 5:110837680-110837702 CTTCACAATAAGAACCAGGCGGG + Intergenic
996471645 5:123867882-123867904 TTTCAAAATTAGAAAGAGGAAGG + Intergenic
997915456 5:137920395-137920417 CTTTAAAATTAGAAAAAGGAAGG + Intronic
999380520 5:151117991-151118013 TTACAAAATCAGCAGGAGGATGG - Intronic
1003640843 6:7873946-7873968 CTTCACAAGCAGAATGAGGTTGG + Intronic
1003665834 6:8110485-8110507 CTTCAACATCAGCATGTGGATGG - Intergenic
1003747305 6:9017133-9017155 CCTCAAAATCAGGAGGAGGATGG - Intergenic
1006677558 6:35775402-35775424 CTTCAAAAGCAGAAGCAGGCTGG + Intergenic
1007021705 6:38527835-38527857 CATGAAAATCAGAAATAGGAAGG + Intronic
1007119625 6:39369255-39369277 TTACAAAATCAGCACCAGGATGG - Intronic
1007450848 6:41939762-41939784 CCTCAGAATGAGGACGAGGAAGG + Intronic
1008845913 6:55964015-55964037 CTTCAGAATCAGAAGGTGGCAGG - Intergenic
1010057298 6:71581622-71581644 CTTTAAAATGAGAATGATGATGG - Intergenic
1012468454 6:99541875-99541897 CTTCAAAATAAGATGGGGGATGG + Intergenic
1013085328 6:106852009-106852031 CTTCAGTCTCTGAACGAGGAGGG - Intergenic
1015627809 6:135199398-135199420 CTTCAGAATAAGAACGAGTATGG + Intronic
1016005007 6:139080173-139080195 CTTTCTAATCAGAAGGAGGAGGG + Intergenic
1016848950 6:148597099-148597121 CTGCAAAACCATAACAAGGATGG + Intergenic
1017437715 6:154432973-154432995 CCTCAACATCAGTAGGAGGAAGG + Intronic
1017515816 6:155154867-155154889 TTTTAAAATCATAAAGAGGACGG + Intronic
1018900258 6:168048364-168048386 CTTCAAGGTCAGAAGGAGGACGG - Intergenic
1021111135 7:16696033-16696055 CTTCAAAAGCAGAAGGAGCCGGG - Intronic
1022033245 7:26511647-26511669 CGTCAAAATCAGAAACAGCAGGG + Intergenic
1022974352 7:35543955-35543977 CTTCACTATCAGAACGTGGTAGG - Intergenic
1023359327 7:39399687-39399709 CTACAAAATCAGAAAAAGGCAGG + Intronic
1024241296 7:47438579-47438601 CTTCAAGACCAGAAAGAGGCAGG + Intronic
1029973191 7:104809435-104809457 CCTCAAAGGCAGAACGTGGATGG - Intronic
1032564519 7:132928123-132928145 CTTCCTAGTCAGAATGAGGAAGG + Intronic
1033274369 7:139960020-139960042 TTTGAAAATCAGAACGAGCAGGG + Intronic
1034058426 7:148061690-148061712 CTTCAAAACCAGAATGGGGGAGG + Intronic
1035379512 7:158428756-158428778 CTTCCCCATCAGAACCAGGAAGG - Intronic
1035646716 8:1228417-1228439 TTTCAAAATCAGAAGTTGGAGGG + Intergenic
1036659926 8:10701363-10701385 CCTCAAAATCAGAACAGTGAGGG + Intronic
1036700323 8:11008947-11008969 CTTCCAACTCAGAAAGAGCAAGG + Intronic
1039895268 8:41712666-41712688 CATCAAAATTAGAAAGGGGAGGG + Intronic
1040730303 8:50437869-50437891 CTTCAAAATCACAAAGATGATGG - Intronic
1040873023 8:52120494-52120516 TTTCAAGATCAGAAGGAGGCAGG + Intronic
1042020357 8:64367570-64367592 CTTTAAAACCAGAACAAGTATGG - Intergenic
1044376044 8:91472300-91472322 CTGCAAAATCAGAAAGGAGATGG - Intergenic
1046943803 8:119956273-119956295 CTTCAAAATAAGAACCTGGATGG + Intronic
1047478047 8:125254433-125254455 CTTCAGAATCTGAATGAGCATGG - Intronic
1047878395 8:129166303-129166325 CTTTAAAATCTGATAGAGGAGGG + Intergenic
1050472201 9:6005712-6005734 CTTCAAAATAATAACGTGAATGG + Intronic
1051367874 9:16334060-16334082 CTTCCAAATCAGCCCCAGGACGG + Intergenic
1052944671 9:34158642-34158664 CTTCAACATAAGAACTTGGAGGG - Intergenic
1053607343 9:39673870-39673892 CTTCAAAGTCACCATGAGGAAGG - Intergenic
1053865192 9:42430223-42430245 CTTCAAAGTCACCATGAGGAAGG - Intergenic
1054246190 9:62668539-62668561 CTTCAAAGTCACCATGAGGAAGG + Intergenic
1054560312 9:66703072-66703094 CTTCAAAGTCACCATGAGGAAGG + Intergenic
1055114209 9:72589661-72589683 TCTCAAAATCAGAAAAAGGATGG - Intronic
1055543246 9:77337560-77337582 CTACAAAATCAAAAACAGGAAGG - Intronic
1059281390 9:113136928-113136950 CTTCACAATCAGGACAAGGAGGG + Intergenic
1060284259 9:122234911-122234933 CTTCAAAATAGGAACTATGAGGG + Intergenic
1061222227 9:129258771-129258793 CTTCAAAATAAAAAGGAAGAGGG - Intergenic
1061541617 9:131280532-131280554 CTGAAAAATGAGAAAGAGGAGGG + Intergenic
1186441285 X:9588897-9588919 TTTAAAAATCAAAATGAGGACGG - Intronic
1187128579 X:16478584-16478606 CTTAATAAACAGAATGAGGAAGG + Intergenic
1193632994 X:83912420-83912442 CTTCCAGATCACAATGAGGAGGG - Intergenic
1195514472 X:105757594-105757616 CTTTAAAATCAGACTGAGTAGGG + Intronic
1200624069 Y:5490682-5490704 CCTCCAATTCAGAAGGAGGAGGG - Intronic
1201851220 Y:18483053-18483075 TTTCAAAATCATAATTAGGAGGG - Intergenic
1201882099 Y:18837325-18837347 TTTCAAAATCATAATTAGGAGGG + Intergenic