ID: 1152918045

View in Genome Browser
Species Human (GRCh38)
Location 17:83052025-83052047
Sequence GGGAGAGCAGGAGGCTTCCA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152918045_1152918055 25 Left 1152918045 17:83052025-83052047 CCGTGGAAGCCTCCTGCTCTCCC No data
Right 1152918055 17:83052073-83052095 TCCCCCGTAGACGCCGCCGCGGG No data
1152918045_1152918057 26 Left 1152918045 17:83052025-83052047 CCGTGGAAGCCTCCTGCTCTCCC No data
Right 1152918057 17:83052074-83052096 CCCCCGTAGACGCCGCCGCGGGG No data
1152918045_1152918054 24 Left 1152918045 17:83052025-83052047 CCGTGGAAGCCTCCTGCTCTCCC No data
Right 1152918054 17:83052072-83052094 GTCCCCCGTAGACGCCGCCGCGG No data
1152918045_1152918053 2 Left 1152918045 17:83052025-83052047 CCGTGGAAGCCTCCTGCTCTCCC No data
Right 1152918053 17:83052050-83052072 AGGGCGCGCGTCACAATCTCTGG No data
1152918045_1152918061 30 Left 1152918045 17:83052025-83052047 CCGTGGAAGCCTCCTGCTCTCCC No data
Right 1152918061 17:83052078-83052100 CGTAGACGCCGCCGCGGGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152918045 Original CRISPR GGGAGAGCAGGAGGCTTCCA CGG (reversed) Intergenic