ID: 1152918048

View in Genome Browser
Species Human (GRCh38)
Location 17:83052034-83052056
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152918048_1152918064 26 Left 1152918048 17:83052034-83052056 CCTCCTGCTCTCCCCTAGGGCGC No data
Right 1152918064 17:83052083-83052105 ACGCCGCCGCGGGGAAGGCGGGG No data
1152918048_1152918062 24 Left 1152918048 17:83052034-83052056 CCTCCTGCTCTCCCCTAGGGCGC No data
Right 1152918062 17:83052081-83052103 AGACGCCGCCGCGGGGAAGGCGG 0: 1
1: 0
2: 1
3: 9
4: 126
1152918048_1152918054 15 Left 1152918048 17:83052034-83052056 CCTCCTGCTCTCCCCTAGGGCGC No data
Right 1152918054 17:83052072-83052094 GTCCCCCGTAGACGCCGCCGCGG 0: 1
1: 0
2: 0
3: 5
4: 47
1152918048_1152918063 25 Left 1152918048 17:83052034-83052056 CCTCCTGCTCTCCCCTAGGGCGC No data
Right 1152918063 17:83052082-83052104 GACGCCGCCGCGGGGAAGGCGGG No data
1152918048_1152918057 17 Left 1152918048 17:83052034-83052056 CCTCCTGCTCTCCCCTAGGGCGC No data
Right 1152918057 17:83052074-83052096 CCCCCGTAGACGCCGCCGCGGGG No data
1152918048_1152918055 16 Left 1152918048 17:83052034-83052056 CCTCCTGCTCTCCCCTAGGGCGC No data
Right 1152918055 17:83052073-83052095 TCCCCCGTAGACGCCGCCGCGGG No data
1152918048_1152918053 -7 Left 1152918048 17:83052034-83052056 CCTCCTGCTCTCCCCTAGGGCGC No data
Right 1152918053 17:83052050-83052072 AGGGCGCGCGTCACAATCTCTGG No data
1152918048_1152918061 21 Left 1152918048 17:83052034-83052056 CCTCCTGCTCTCCCCTAGGGCGC No data
Right 1152918061 17:83052078-83052100 CGTAGACGCCGCCGCGGGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152918048 Original CRISPR GCGCCCTAGGGGAGAGCAGG AGG (reversed) Intergenic