ID: 1152918049

View in Genome Browser
Species Human (GRCh38)
Location 17:83052037-83052059
Sequence CGCGCGCCCTAGGGGAGAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152918049_1152918062 21 Left 1152918049 17:83052037-83052059 CCTGCTCTCCCCTAGGGCGCGCG No data
Right 1152918062 17:83052081-83052103 AGACGCCGCCGCGGGGAAGGCGG No data
1152918049_1152918053 -10 Left 1152918049 17:83052037-83052059 CCTGCTCTCCCCTAGGGCGCGCG No data
Right 1152918053 17:83052050-83052072 AGGGCGCGCGTCACAATCTCTGG No data
1152918049_1152918055 13 Left 1152918049 17:83052037-83052059 CCTGCTCTCCCCTAGGGCGCGCG No data
Right 1152918055 17:83052073-83052095 TCCCCCGTAGACGCCGCCGCGGG No data
1152918049_1152918054 12 Left 1152918049 17:83052037-83052059 CCTGCTCTCCCCTAGGGCGCGCG No data
Right 1152918054 17:83052072-83052094 GTCCCCCGTAGACGCCGCCGCGG No data
1152918049_1152918057 14 Left 1152918049 17:83052037-83052059 CCTGCTCTCCCCTAGGGCGCGCG No data
Right 1152918057 17:83052074-83052096 CCCCCGTAGACGCCGCCGCGGGG No data
1152918049_1152918063 22 Left 1152918049 17:83052037-83052059 CCTGCTCTCCCCTAGGGCGCGCG No data
Right 1152918063 17:83052082-83052104 GACGCCGCCGCGGGGAAGGCGGG No data
1152918049_1152918061 18 Left 1152918049 17:83052037-83052059 CCTGCTCTCCCCTAGGGCGCGCG No data
Right 1152918061 17:83052078-83052100 CGTAGACGCCGCCGCGGGGAAGG No data
1152918049_1152918064 23 Left 1152918049 17:83052037-83052059 CCTGCTCTCCCCTAGGGCGCGCG No data
Right 1152918064 17:83052083-83052105 ACGCCGCCGCGGGGAAGGCGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152918049 Original CRISPR CGCGCGCCCTAGGGGAGAGC AGG (reversed) Intergenic