ID: 1152918050

View in Genome Browser
Species Human (GRCh38)
Location 17:83052045-83052067
Sequence GATTGTGACGCGCGCCCTAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152918050_1152918063 14 Left 1152918050 17:83052045-83052067 CCCCTAGGGCGCGCGTCACAATC No data
Right 1152918063 17:83052082-83052104 GACGCCGCCGCGGGGAAGGCGGG No data
1152918050_1152918068 26 Left 1152918050 17:83052045-83052067 CCCCTAGGGCGCGCGTCACAATC No data
Right 1152918068 17:83052094-83052116 GGGAAGGCGGGGCTGTGCGAGGG 0: 1
1: 0
2: 1
3: 29
4: 339
1152918050_1152918061 10 Left 1152918050 17:83052045-83052067 CCCCTAGGGCGCGCGTCACAATC No data
Right 1152918061 17:83052078-83052100 CGTAGACGCCGCCGCGGGGAAGG No data
1152918050_1152918067 25 Left 1152918050 17:83052045-83052067 CCCCTAGGGCGCGCGTCACAATC No data
Right 1152918067 17:83052093-83052115 GGGGAAGGCGGGGCTGTGCGAGG No data
1152918050_1152918054 4 Left 1152918050 17:83052045-83052067 CCCCTAGGGCGCGCGTCACAATC No data
Right 1152918054 17:83052072-83052094 GTCCCCCGTAGACGCCGCCGCGG 0: 1
1: 0
2: 0
3: 5
4: 47
1152918050_1152918062 13 Left 1152918050 17:83052045-83052067 CCCCTAGGGCGCGCGTCACAATC No data
Right 1152918062 17:83052081-83052103 AGACGCCGCCGCGGGGAAGGCGG 0: 1
1: 0
2: 1
3: 9
4: 126
1152918050_1152918064 15 Left 1152918050 17:83052045-83052067 CCCCTAGGGCGCGCGTCACAATC No data
Right 1152918064 17:83052083-83052105 ACGCCGCCGCGGGGAAGGCGGGG No data
1152918050_1152918057 6 Left 1152918050 17:83052045-83052067 CCCCTAGGGCGCGCGTCACAATC No data
Right 1152918057 17:83052074-83052096 CCCCCGTAGACGCCGCCGCGGGG No data
1152918050_1152918055 5 Left 1152918050 17:83052045-83052067 CCCCTAGGGCGCGCGTCACAATC No data
Right 1152918055 17:83052073-83052095 TCCCCCGTAGACGCCGCCGCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152918050 Original CRISPR GATTGTGACGCGCGCCCTAG GGG (reversed) Intergenic