ID: 1152918052 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 17:83052047-83052069 |
Sequence | GAGATTGTGACGCGCGCCCT AGG (reversed) |
Strand | - |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 9 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1152918052_1152918061 | 8 | Left | 1152918052 | 17:83052047-83052069 | CCTAGGGCGCGCGTCACAATCTC | No data | ||
Right | 1152918061 | 17:83052078-83052100 | CGTAGACGCCGCCGCGGGGAAGG | No data | ||||
1152918052_1152918067 | 23 | Left | 1152918052 | 17:83052047-83052069 | CCTAGGGCGCGCGTCACAATCTC | No data | ||
Right | 1152918067 | 17:83052093-83052115 | GGGGAAGGCGGGGCTGTGCGAGG | No data | ||||
1152918052_1152918064 | 13 | Left | 1152918052 | 17:83052047-83052069 | CCTAGGGCGCGCGTCACAATCTC | No data | ||
Right | 1152918064 | 17:83052083-83052105 | ACGCCGCCGCGGGGAAGGCGGGG | No data | ||||
1152918052_1152918055 | 3 | Left | 1152918052 | 17:83052047-83052069 | CCTAGGGCGCGCGTCACAATCTC | No data | ||
Right | 1152918055 | 17:83052073-83052095 | TCCCCCGTAGACGCCGCCGCGGG | No data | ||||
1152918052_1152918062 | 11 | Left | 1152918052 | 17:83052047-83052069 | CCTAGGGCGCGCGTCACAATCTC | No data | ||
Right | 1152918062 | 17:83052081-83052103 | AGACGCCGCCGCGGGGAAGGCGG | No data | ||||
1152918052_1152918068 | 24 | Left | 1152918052 | 17:83052047-83052069 | CCTAGGGCGCGCGTCACAATCTC | No data | ||
Right | 1152918068 | 17:83052094-83052116 | GGGAAGGCGGGGCTGTGCGAGGG | No data | ||||
1152918052_1152918063 | 12 | Left | 1152918052 | 17:83052047-83052069 | CCTAGGGCGCGCGTCACAATCTC | No data | ||
Right | 1152918063 | 17:83052082-83052104 | GACGCCGCCGCGGGGAAGGCGGG | No data | ||||
1152918052_1152918057 | 4 | Left | 1152918052 | 17:83052047-83052069 | CCTAGGGCGCGCGTCACAATCTC | No data | ||
Right | 1152918057 | 17:83052074-83052096 | CCCCCGTAGACGCCGCCGCGGGG | No data | ||||
1152918052_1152918054 | 2 | Left | 1152918052 | 17:83052047-83052069 | CCTAGGGCGCGCGTCACAATCTC | No data | ||
Right | 1152918054 | 17:83052072-83052094 | GTCCCCCGTAGACGCCGCCGCGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1152918052 | Original CRISPR | GAGATTGTGACGCGCGCCCT AGG (reversed) | Intergenic | ||