ID: 1152918052

View in Genome Browser
Species Human (GRCh38)
Location 17:83052047-83052069
Sequence GAGATTGTGACGCGCGCCCT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152918052_1152918061 8 Left 1152918052 17:83052047-83052069 CCTAGGGCGCGCGTCACAATCTC No data
Right 1152918061 17:83052078-83052100 CGTAGACGCCGCCGCGGGGAAGG No data
1152918052_1152918067 23 Left 1152918052 17:83052047-83052069 CCTAGGGCGCGCGTCACAATCTC No data
Right 1152918067 17:83052093-83052115 GGGGAAGGCGGGGCTGTGCGAGG No data
1152918052_1152918064 13 Left 1152918052 17:83052047-83052069 CCTAGGGCGCGCGTCACAATCTC No data
Right 1152918064 17:83052083-83052105 ACGCCGCCGCGGGGAAGGCGGGG No data
1152918052_1152918055 3 Left 1152918052 17:83052047-83052069 CCTAGGGCGCGCGTCACAATCTC No data
Right 1152918055 17:83052073-83052095 TCCCCCGTAGACGCCGCCGCGGG No data
1152918052_1152918062 11 Left 1152918052 17:83052047-83052069 CCTAGGGCGCGCGTCACAATCTC No data
Right 1152918062 17:83052081-83052103 AGACGCCGCCGCGGGGAAGGCGG No data
1152918052_1152918068 24 Left 1152918052 17:83052047-83052069 CCTAGGGCGCGCGTCACAATCTC No data
Right 1152918068 17:83052094-83052116 GGGAAGGCGGGGCTGTGCGAGGG No data
1152918052_1152918063 12 Left 1152918052 17:83052047-83052069 CCTAGGGCGCGCGTCACAATCTC No data
Right 1152918063 17:83052082-83052104 GACGCCGCCGCGGGGAAGGCGGG No data
1152918052_1152918057 4 Left 1152918052 17:83052047-83052069 CCTAGGGCGCGCGTCACAATCTC No data
Right 1152918057 17:83052074-83052096 CCCCCGTAGACGCCGCCGCGGGG No data
1152918052_1152918054 2 Left 1152918052 17:83052047-83052069 CCTAGGGCGCGCGTCACAATCTC No data
Right 1152918054 17:83052072-83052094 GTCCCCCGTAGACGCCGCCGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152918052 Original CRISPR GAGATTGTGACGCGCGCCCT AGG (reversed) Intergenic