ID: 1152918053

View in Genome Browser
Species Human (GRCh38)
Location 17:83052050-83052072
Sequence AGGGCGCGCGTCACAATCTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152918042_1152918053 12 Left 1152918042 17:83052015-83052037 CCTCCTTGGCCCGTGGAAGCCTC No data
Right 1152918053 17:83052050-83052072 AGGGCGCGCGTCACAATCTCTGG No data
1152918039_1152918053 25 Left 1152918039 17:83052002-83052024 CCTCTCGGAGCCGCCTCCTTGGC 0: 1
1: 0
2: 2
3: 14
4: 162
Right 1152918053 17:83052050-83052072 AGGGCGCGCGTCACAATCTCTGG No data
1152918045_1152918053 2 Left 1152918045 17:83052025-83052047 CCGTGGAAGCCTCCTGCTCTCCC No data
Right 1152918053 17:83052050-83052072 AGGGCGCGCGTCACAATCTCTGG No data
1152918049_1152918053 -10 Left 1152918049 17:83052037-83052059 CCTGCTCTCCCCTAGGGCGCGCG No data
Right 1152918053 17:83052050-83052072 AGGGCGCGCGTCACAATCTCTGG No data
1152918041_1152918053 15 Left 1152918041 17:83052012-83052034 CCGCCTCCTTGGCCCGTGGAAGC No data
Right 1152918053 17:83052050-83052072 AGGGCGCGCGTCACAATCTCTGG No data
1152918043_1152918053 9 Left 1152918043 17:83052018-83052040 CCTTGGCCCGTGGAAGCCTCCTG No data
Right 1152918053 17:83052050-83052072 AGGGCGCGCGTCACAATCTCTGG No data
1152918048_1152918053 -7 Left 1152918048 17:83052034-83052056 CCTCCTGCTCTCCCCTAGGGCGC No data
Right 1152918053 17:83052050-83052072 AGGGCGCGCGTCACAATCTCTGG No data
1152918044_1152918053 3 Left 1152918044 17:83052024-83052046 CCCGTGGAAGCCTCCTGCTCTCC No data
Right 1152918053 17:83052050-83052072 AGGGCGCGCGTCACAATCTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152918053 Original CRISPR AGGGCGCGCGTCACAATCTC TGG Intergenic