ID: 1152918054

View in Genome Browser
Species Human (GRCh38)
Location 17:83052072-83052094
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152918048_1152918054 15 Left 1152918048 17:83052034-83052056 CCTCCTGCTCTCCCCTAGGGCGC No data
Right 1152918054 17:83052072-83052094 GTCCCCCGTAGACGCCGCCGCGG No data
1152918044_1152918054 25 Left 1152918044 17:83052024-83052046 CCCGTGGAAGCCTCCTGCTCTCC No data
Right 1152918054 17:83052072-83052094 GTCCCCCGTAGACGCCGCCGCGG No data
1152918049_1152918054 12 Left 1152918049 17:83052037-83052059 CCTGCTCTCCCCTAGGGCGCGCG No data
Right 1152918054 17:83052072-83052094 GTCCCCCGTAGACGCCGCCGCGG No data
1152918051_1152918054 3 Left 1152918051 17:83052046-83052068 CCCTAGGGCGCGCGTCACAATCT No data
Right 1152918054 17:83052072-83052094 GTCCCCCGTAGACGCCGCCGCGG No data
1152918045_1152918054 24 Left 1152918045 17:83052025-83052047 CCGTGGAAGCCTCCTGCTCTCCC No data
Right 1152918054 17:83052072-83052094 GTCCCCCGTAGACGCCGCCGCGG No data
1152918052_1152918054 2 Left 1152918052 17:83052047-83052069 CCTAGGGCGCGCGTCACAATCTC No data
Right 1152918054 17:83052072-83052094 GTCCCCCGTAGACGCCGCCGCGG No data
1152918050_1152918054 4 Left 1152918050 17:83052045-83052067 CCCCTAGGGCGCGCGTCACAATC No data
Right 1152918054 17:83052072-83052094 GTCCCCCGTAGACGCCGCCGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152918054 Original CRISPR GTCCCCCGTAGACGCCGCCG CGG Intergenic