ID: 1152918061

View in Genome Browser
Species Human (GRCh38)
Location 17:83052078-83052100
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152918045_1152918061 30 Left 1152918045 17:83052025-83052047 CCGTGGAAGCCTCCTGCTCTCCC No data
Right 1152918061 17:83052078-83052100 CGTAGACGCCGCCGCGGGGAAGG No data
1152918051_1152918061 9 Left 1152918051 17:83052046-83052068 CCCTAGGGCGCGCGTCACAATCT No data
Right 1152918061 17:83052078-83052100 CGTAGACGCCGCCGCGGGGAAGG No data
1152918050_1152918061 10 Left 1152918050 17:83052045-83052067 CCCCTAGGGCGCGCGTCACAATC No data
Right 1152918061 17:83052078-83052100 CGTAGACGCCGCCGCGGGGAAGG No data
1152918052_1152918061 8 Left 1152918052 17:83052047-83052069 CCTAGGGCGCGCGTCACAATCTC No data
Right 1152918061 17:83052078-83052100 CGTAGACGCCGCCGCGGGGAAGG No data
1152918048_1152918061 21 Left 1152918048 17:83052034-83052056 CCTCCTGCTCTCCCCTAGGGCGC No data
Right 1152918061 17:83052078-83052100 CGTAGACGCCGCCGCGGGGAAGG No data
1152918049_1152918061 18 Left 1152918049 17:83052037-83052059 CCTGCTCTCCCCTAGGGCGCGCG No data
Right 1152918061 17:83052078-83052100 CGTAGACGCCGCCGCGGGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152918061 Original CRISPR CGTAGACGCCGCCGCGGGGA AGG Intergenic