ID: 1152918068

View in Genome Browser
Species Human (GRCh38)
Location 17:83052094-83052116
Sequence GGGAAGGCGGGGCTGTGCGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152918050_1152918068 26 Left 1152918050 17:83052045-83052067 CCCCTAGGGCGCGCGTCACAATC No data
Right 1152918068 17:83052094-83052116 GGGAAGGCGGGGCTGTGCGAGGG No data
1152918060_1152918068 -6 Left 1152918060 17:83052077-83052099 CCGTAGACGCCGCCGCGGGGAAG No data
Right 1152918068 17:83052094-83052116 GGGAAGGCGGGGCTGTGCGAGGG No data
1152918059_1152918068 -5 Left 1152918059 17:83052076-83052098 CCCGTAGACGCCGCCGCGGGGAA No data
Right 1152918068 17:83052094-83052116 GGGAAGGCGGGGCTGTGCGAGGG No data
1152918058_1152918068 -4 Left 1152918058 17:83052075-83052097 CCCCGTAGACGCCGCCGCGGGGA No data
Right 1152918068 17:83052094-83052116 GGGAAGGCGGGGCTGTGCGAGGG No data
1152918052_1152918068 24 Left 1152918052 17:83052047-83052069 CCTAGGGCGCGCGTCACAATCTC No data
Right 1152918068 17:83052094-83052116 GGGAAGGCGGGGCTGTGCGAGGG No data
1152918056_1152918068 -3 Left 1152918056 17:83052074-83052096 CCCCCGTAGACGCCGCCGCGGGG No data
Right 1152918068 17:83052094-83052116 GGGAAGGCGGGGCTGTGCGAGGG No data
1152918051_1152918068 25 Left 1152918051 17:83052046-83052068 CCCTAGGGCGCGCGTCACAATCT No data
Right 1152918068 17:83052094-83052116 GGGAAGGCGGGGCTGTGCGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152918068 Original CRISPR GGGAAGGCGGGGCTGTGCGA GGG Intergenic