ID: 1152918372

View in Genome Browser
Species Human (GRCh38)
Location 17:83052972-83052994
Sequence CTCCCGGGCACCCCTCCTCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152918372_1152918388 25 Left 1152918372 17:83052972-83052994 CCAGGAGGAGGGGTGCCCGGGAG No data
Right 1152918388 17:83053020-83053042 CCCCCAGGAGAAGGGGTGCCTGG No data
1152918372_1152918390 26 Left 1152918372 17:83052972-83052994 CCAGGAGGAGGGGTGCCCGGGAG No data
Right 1152918390 17:83053021-83053043 CCCCAGGAGAAGGGGTGCCTGGG No data
1152918372_1152918379 10 Left 1152918372 17:83052972-83052994 CCAGGAGGAGGGGTGCCCGGGAG No data
Right 1152918379 17:83053005-83053027 ACCCCACCGTGAGGTCCCCCAGG No data
1152918372_1152918385 17 Left 1152918372 17:83052972-83052994 CCAGGAGGAGGGGTGCCCGGGAG No data
Right 1152918385 17:83053012-83053034 CGTGAGGTCCCCCAGGAGAAGGG No data
1152918372_1152918386 18 Left 1152918372 17:83052972-83052994 CCAGGAGGAGGGGTGCCCGGGAG No data
Right 1152918386 17:83053013-83053035 GTGAGGTCCCCCAGGAGAAGGGG No data
1152918372_1152918392 27 Left 1152918372 17:83052972-83052994 CCAGGAGGAGGGGTGCCCGGGAG No data
Right 1152918392 17:83053022-83053044 CCCAGGAGAAGGGGTGCCTGGGG No data
1152918372_1152918376 1 Left 1152918372 17:83052972-83052994 CCAGGAGGAGGGGTGCCCGGGAG No data
Right 1152918376 17:83052996-83053018 GAGGCCCTGACCCCACCGTGAGG No data
1152918372_1152918384 16 Left 1152918372 17:83052972-83052994 CCAGGAGGAGGGGTGCCCGGGAG No data
Right 1152918384 17:83053011-83053033 CCGTGAGGTCCCCCAGGAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152918372 Original CRISPR CTCCCGGGCACCCCTCCTCC TGG (reversed) Intergenic
No off target data available for this crispr