ID: 1152918374

View in Genome Browser
Species Human (GRCh38)
Location 17:83052987-83053009
Sequence GGGGTCAGGGCCTCACTCCC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152918374_1152918385 2 Left 1152918374 17:83052987-83053009 CCCGGGAGTGAGGCCCTGACCCC No data
Right 1152918385 17:83053012-83053034 CGTGAGGTCCCCCAGGAGAAGGG No data
1152918374_1152918390 11 Left 1152918374 17:83052987-83053009 CCCGGGAGTGAGGCCCTGACCCC No data
Right 1152918390 17:83053021-83053043 CCCCAGGAGAAGGGGTGCCTGGG No data
1152918374_1152918388 10 Left 1152918374 17:83052987-83053009 CCCGGGAGTGAGGCCCTGACCCC No data
Right 1152918388 17:83053020-83053042 CCCCCAGGAGAAGGGGTGCCTGG No data
1152918374_1152918392 12 Left 1152918374 17:83052987-83053009 CCCGGGAGTGAGGCCCTGACCCC No data
Right 1152918392 17:83053022-83053044 CCCAGGAGAAGGGGTGCCTGGGG No data
1152918374_1152918379 -5 Left 1152918374 17:83052987-83053009 CCCGGGAGTGAGGCCCTGACCCC No data
Right 1152918379 17:83053005-83053027 ACCCCACCGTGAGGTCCCCCAGG No data
1152918374_1152918386 3 Left 1152918374 17:83052987-83053009 CCCGGGAGTGAGGCCCTGACCCC No data
Right 1152918386 17:83053013-83053035 GTGAGGTCCCCCAGGAGAAGGGG No data
1152918374_1152918384 1 Left 1152918374 17:83052987-83053009 CCCGGGAGTGAGGCCCTGACCCC No data
Right 1152918384 17:83053011-83053033 CCGTGAGGTCCCCCAGGAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152918374 Original CRISPR GGGGTCAGGGCCTCACTCCC GGG (reversed) Intergenic
No off target data available for this crispr