ID: 1152918377

View in Genome Browser
Species Human (GRCh38)
Location 17:83053000-83053022
Sequence GGGACCTCACGGTGGGGTCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152918377_1152918390 -2 Left 1152918377 17:83053000-83053022 CCCTGACCCCACCGTGAGGTCCC No data
Right 1152918390 17:83053021-83053043 CCCCAGGAGAAGGGGTGCCTGGG No data
1152918377_1152918386 -10 Left 1152918377 17:83053000-83053022 CCCTGACCCCACCGTGAGGTCCC No data
Right 1152918386 17:83053013-83053035 GTGAGGTCCCCCAGGAGAAGGGG No data
1152918377_1152918396 25 Left 1152918377 17:83053000-83053022 CCCTGACCCCACCGTGAGGTCCC No data
Right 1152918396 17:83053048-83053070 GACATGACCTCAGTAGCTCCGGG No data
1152918377_1152918392 -1 Left 1152918377 17:83053000-83053022 CCCTGACCCCACCGTGAGGTCCC No data
Right 1152918392 17:83053022-83053044 CCCAGGAGAAGGGGTGCCTGGGG No data
1152918377_1152918388 -3 Left 1152918377 17:83053000-83053022 CCCTGACCCCACCGTGAGGTCCC No data
Right 1152918388 17:83053020-83053042 CCCCCAGGAGAAGGGGTGCCTGG No data
1152918377_1152918395 24 Left 1152918377 17:83053000-83053022 CCCTGACCCCACCGTGAGGTCCC No data
Right 1152918395 17:83053047-83053069 AGACATGACCTCAGTAGCTCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152918377 Original CRISPR GGGACCTCACGGTGGGGTCA GGG (reversed) Intergenic
No off target data available for this crispr