ID: 1152918382

View in Genome Browser
Species Human (GRCh38)
Location 17:83053008-83053030
Sequence TCTCCTGGGGGACCTCACGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152918382_1152918390 -10 Left 1152918382 17:83053008-83053030 CCACCGTGAGGTCCCCCAGGAGA No data
Right 1152918390 17:83053021-83053043 CCCCAGGAGAAGGGGTGCCTGGG No data
1152918382_1152918396 17 Left 1152918382 17:83053008-83053030 CCACCGTGAGGTCCCCCAGGAGA No data
Right 1152918396 17:83053048-83053070 GACATGACCTCAGTAGCTCCGGG No data
1152918382_1152918395 16 Left 1152918382 17:83053008-83053030 CCACCGTGAGGTCCCCCAGGAGA No data
Right 1152918395 17:83053047-83053069 AGACATGACCTCAGTAGCTCCGG No data
1152918382_1152918392 -9 Left 1152918382 17:83053008-83053030 CCACCGTGAGGTCCCCCAGGAGA No data
Right 1152918392 17:83053022-83053044 CCCAGGAGAAGGGGTGCCTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152918382 Original CRISPR TCTCCTGGGGGACCTCACGG TGG (reversed) Intergenic
No off target data available for this crispr