ID: 1152918390

View in Genome Browser
Species Human (GRCh38)
Location 17:83053021-83053043
Sequence CCCCAGGAGAAGGGGTGCCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152918382_1152918390 -10 Left 1152918382 17:83053008-83053030 CCACCGTGAGGTCCCCCAGGAGA No data
Right 1152918390 17:83053021-83053043 CCCCAGGAGAAGGGGTGCCTGGG No data
1152918375_1152918390 10 Left 1152918375 17:83052988-83053010 CCGGGAGTGAGGCCCTGACCCCA No data
Right 1152918390 17:83053021-83053043 CCCCAGGAGAAGGGGTGCCTGGG No data
1152918377_1152918390 -2 Left 1152918377 17:83053000-83053022 CCCTGACCCCACCGTGAGGTCCC No data
Right 1152918390 17:83053021-83053043 CCCCAGGAGAAGGGGTGCCTGGG No data
1152918380_1152918390 -8 Left 1152918380 17:83053006-83053028 CCCCACCGTGAGGTCCCCCAGGA No data
Right 1152918390 17:83053021-83053043 CCCCAGGAGAAGGGGTGCCTGGG No data
1152918372_1152918390 26 Left 1152918372 17:83052972-83052994 CCAGGAGGAGGGGTGCCCGGGAG No data
Right 1152918390 17:83053021-83053043 CCCCAGGAGAAGGGGTGCCTGGG No data
1152918381_1152918390 -9 Left 1152918381 17:83053007-83053029 CCCACCGTGAGGTCCCCCAGGAG No data
Right 1152918390 17:83053021-83053043 CCCCAGGAGAAGGGGTGCCTGGG No data
1152918378_1152918390 -3 Left 1152918378 17:83053001-83053023 CCTGACCCCACCGTGAGGTCCCC No data
Right 1152918390 17:83053021-83053043 CCCCAGGAGAAGGGGTGCCTGGG No data
1152918374_1152918390 11 Left 1152918374 17:83052987-83053009 CCCGGGAGTGAGGCCCTGACCCC No data
Right 1152918390 17:83053021-83053043 CCCCAGGAGAAGGGGTGCCTGGG No data
1152918369_1152918390 29 Left 1152918369 17:83052969-83052991 CCTCCAGGAGGAGGGGTGCCCGG No data
Right 1152918390 17:83053021-83053043 CCCCAGGAGAAGGGGTGCCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152918390 Original CRISPR CCCCAGGAGAAGGGGTGCCT GGG Intergenic
No off target data available for this crispr