ID: 1152918418

View in Genome Browser
Species Human (GRCh38)
Location 17:83053130-83053152
Sequence GGGAACCCGGAGAAGGCGGC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152918402_1152918418 27 Left 1152918402 17:83053080-83053102 CCTTTGCCCTCATTTCCGCCTCC No data
Right 1152918418 17:83053130-83053152 GGGAACCCGGAGAAGGCGGCCGG No data
1152918414_1152918418 -4 Left 1152918414 17:83053111-83053133 CCTTGGGAACTGCAGGGCTGGGA No data
Right 1152918418 17:83053130-83053152 GGGAACCCGGAGAAGGCGGCCGG No data
1152918408_1152918418 9 Left 1152918408 17:83053098-83053120 CCTCCGCATGCAGCCTTGGGAAC No data
Right 1152918418 17:83053130-83053152 GGGAACCCGGAGAAGGCGGCCGG No data
1152918409_1152918418 6 Left 1152918409 17:83053101-83053123 CCGCATGCAGCCTTGGGAACTGC No data
Right 1152918418 17:83053130-83053152 GGGAACCCGGAGAAGGCGGCCGG No data
1152918406_1152918418 12 Left 1152918406 17:83053095-83053117 CCGCCTCCGCATGCAGCCTTGGG No data
Right 1152918418 17:83053130-83053152 GGGAACCCGGAGAAGGCGGCCGG No data
1152918401_1152918418 30 Left 1152918401 17:83053077-83053099 CCACCTTTGCCCTCATTTCCGCC No data
Right 1152918418 17:83053130-83053152 GGGAACCCGGAGAAGGCGGCCGG No data
1152918403_1152918418 21 Left 1152918403 17:83053086-83053108 CCCTCATTTCCGCCTCCGCATGC No data
Right 1152918418 17:83053130-83053152 GGGAACCCGGAGAAGGCGGCCGG No data
1152918404_1152918418 20 Left 1152918404 17:83053087-83053109 CCTCATTTCCGCCTCCGCATGCA No data
Right 1152918418 17:83053130-83053152 GGGAACCCGGAGAAGGCGGCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152918418 Original CRISPR GGGAACCCGGAGAAGGCGGC CGG Intergenic
No off target data available for this crispr