ID: 1152919850

View in Genome Browser
Species Human (GRCh38)
Location 17:83060768-83060790
Sequence CCGGGTCCCACAGGCTGTAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152919850_1152919860 29 Left 1152919850 17:83060768-83060790 CCTGTACAGCCTGTGGGACCCGG No data
Right 1152919860 17:83060820-83060842 TACCCAGACTCGGCCGGGCACGG No data
1152919850_1152919858 23 Left 1152919850 17:83060768-83060790 CCTGTACAGCCTGTGGGACCCGG No data
Right 1152919858 17:83060814-83060836 ATAAATTACCCAGACTCGGCCGG No data
1152919850_1152919859 24 Left 1152919850 17:83060768-83060790 CCTGTACAGCCTGTGGGACCCGG No data
Right 1152919859 17:83060815-83060837 TAAATTACCCAGACTCGGCCGGG No data
1152919850_1152919857 19 Left 1152919850 17:83060768-83060790 CCTGTACAGCCTGTGGGACCCGG No data
Right 1152919857 17:83060810-83060832 CTTTATAAATTACCCAGACTCGG 0: 50
1: 3713
2: 4601
3: 3269
4: 3603

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152919850 Original CRISPR CCGGGTCCCACAGGCTGTAC AGG (reversed) Intergenic
No off target data available for this crispr