ID: 1152920781

View in Genome Browser
Species Human (GRCh38)
Location 17:83065523-83065545
Sequence GTTCTCAGTGGACACCAACG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152920776_1152920781 -8 Left 1152920776 17:83065508-83065530 CCAAGCAACTTTCCAGTTCTCAG No data
Right 1152920781 17:83065523-83065545 GTTCTCAGTGGACACCAACGGGG No data
1152920775_1152920781 14 Left 1152920775 17:83065486-83065508 CCAAATGTGCGGGATTTTCACAC No data
Right 1152920781 17:83065523-83065545 GTTCTCAGTGGACACCAACGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152920781 Original CRISPR GTTCTCAGTGGACACCAACG GGG Intergenic
No off target data available for this crispr