ID: 1152921361

View in Genome Browser
Species Human (GRCh38)
Location 17:83068150-83068172
Sequence CGACAGCGGGGGCGACAGCG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152921349_1152921361 0 Left 1152921349 17:83068127-83068149 CCCGAAATCCCACCTGCAGGAGG No data
Right 1152921361 17:83068150-83068172 CGACAGCGGGGGCGACAGCGGGG No data
1152921345_1152921361 11 Left 1152921345 17:83068116-83068138 CCCAAGAACCTCCCGAAATCCCA No data
Right 1152921361 17:83068150-83068172 CGACAGCGGGGGCGACAGCGGGG No data
1152921344_1152921361 29 Left 1152921344 17:83068098-83068120 CCACGGGGATGAGAATGACCCAA No data
Right 1152921361 17:83068150-83068172 CGACAGCGGGGGCGACAGCGGGG No data
1152921351_1152921361 -1 Left 1152921351 17:83068128-83068150 CCGAAATCCCACCTGCAGGAGGC No data
Right 1152921361 17:83068150-83068172 CGACAGCGGGGGCGACAGCGGGG No data
1152921346_1152921361 10 Left 1152921346 17:83068117-83068139 CCAAGAACCTCCCGAAATCCCAC No data
Right 1152921361 17:83068150-83068172 CGACAGCGGGGGCGACAGCGGGG No data
1152921352_1152921361 -8 Left 1152921352 17:83068135-83068157 CCCACCTGCAGGAGGCGACAGCG No data
Right 1152921361 17:83068150-83068172 CGACAGCGGGGGCGACAGCGGGG No data
1152921353_1152921361 -9 Left 1152921353 17:83068136-83068158 CCACCTGCAGGAGGCGACAGCGG No data
Right 1152921361 17:83068150-83068172 CGACAGCGGGGGCGACAGCGGGG No data
1152921347_1152921361 3 Left 1152921347 17:83068124-83068146 CCTCCCGAAATCCCACCTGCAGG No data
Right 1152921361 17:83068150-83068172 CGACAGCGGGGGCGACAGCGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152921361 Original CRISPR CGACAGCGGGGGCGACAGCG GGG Intergenic
No off target data available for this crispr