ID: 1152921539

View in Genome Browser
Species Human (GRCh38)
Location 17:83068627-83068649
Sequence CGACAGCGGGGGCGACAGCG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152921522_1152921539 20 Left 1152921522 17:83068584-83068606 CCCGGGAGGCGACAGCGGCGGTG No data
Right 1152921539 17:83068627-83068649 CGACAGCGGGGGCGACAGCGGGG No data
1152921523_1152921539 19 Left 1152921523 17:83068585-83068607 CCGGGAGGCGACAGCGGCGGTGA No data
Right 1152921539 17:83068627-83068649 CGACAGCGGGGGCGACAGCGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152921539 Original CRISPR CGACAGCGGGGGCGACAGCG GGG Intergenic
No off target data available for this crispr