ID: 1152921599

View in Genome Browser
Species Human (GRCh38)
Location 17:83068777-83068799
Sequence GCGACAACGGGGGTCCCGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152921591_1152921599 -2 Left 1152921591 17:83068756-83068778 CCCGGGAGGCGACAGCGGGGGGC No data
Right 1152921599 17:83068777-83068799 GCGACAACGGGGGTCCCGGGAGG No data
1152921592_1152921599 -3 Left 1152921592 17:83068757-83068779 CCGGGAGGCGACAGCGGGGGGCG No data
Right 1152921599 17:83068777-83068799 GCGACAACGGGGGTCCCGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152921599 Original CRISPR GCGACAACGGGGGTCCCGGG AGG Intergenic