ID: 1152921599 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 17:83068777-83068799 |
Sequence | GCGACAACGGGGGTCCCGGG AGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1152921591_1152921599 | -2 | Left | 1152921591 | 17:83068756-83068778 | CCCGGGAGGCGACAGCGGGGGGC | No data | ||
Right | 1152921599 | 17:83068777-83068799 | GCGACAACGGGGGTCCCGGGAGG | No data | ||||
1152921592_1152921599 | -3 | Left | 1152921592 | 17:83068757-83068779 | CCGGGAGGCGACAGCGGGGGGCG | No data | ||
Right | 1152921599 | 17:83068777-83068799 | GCGACAACGGGGGTCCCGGGAGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1152921599 | Original CRISPR | GCGACAACGGGGGTCCCGGG AGG | Intergenic | ||