ID: 1152922750

View in Genome Browser
Species Human (GRCh38)
Location 17:83073964-83073986
Sequence CCGCCCAGGGTCAGATGGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152922750_1152922757 -9 Left 1152922750 17:83073964-83073986 CCAGCCCATCTGACCCTGGGCGG No data
Right 1152922757 17:83073978-83074000 CCTGGGCGGTCCCCGGTTCCCGG No data
1152922750_1152922764 26 Left 1152922750 17:83073964-83073986 CCAGCCCATCTGACCCTGGGCGG No data
Right 1152922764 17:83074013-83074035 TGACAAGGCCTTGCCTCCTTCGG No data
1152922750_1152922763 11 Left 1152922750 17:83073964-83073986 CCAGCCCATCTGACCCTGGGCGG No data
Right 1152922763 17:83073998-83074020 CGGCTTAACAGATGTTGACAAGG No data
1152922750_1152922765 27 Left 1152922750 17:83073964-83073986 CCAGCCCATCTGACCCTGGGCGG No data
Right 1152922765 17:83074014-83074036 GACAAGGCCTTGCCTCCTTCGGG No data
1152922750_1152922766 28 Left 1152922750 17:83073964-83073986 CCAGCCCATCTGACCCTGGGCGG No data
Right 1152922766 17:83074015-83074037 ACAAGGCCTTGCCTCCTTCGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152922750 Original CRISPR CCGCCCAGGGTCAGATGGGC TGG (reversed) Intergenic
No off target data available for this crispr