ID: 1152922752

View in Genome Browser
Species Human (GRCh38)
Location 17:83073968-83073990
Sequence GGGACCGCCCAGGGTCAGAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152922752_1152922766 24 Left 1152922752 17:83073968-83073990 CCCATCTGACCCTGGGCGGTCCC No data
Right 1152922766 17:83074015-83074037 ACAAGGCCTTGCCTCCTTCGGGG No data
1152922752_1152922763 7 Left 1152922752 17:83073968-83073990 CCCATCTGACCCTGGGCGGTCCC No data
Right 1152922763 17:83073998-83074020 CGGCTTAACAGATGTTGACAAGG No data
1152922752_1152922767 27 Left 1152922752 17:83073968-83073990 CCCATCTGACCCTGGGCGGTCCC No data
Right 1152922767 17:83074018-83074040 AGGCCTTGCCTCCTTCGGGGTGG No data
1152922752_1152922764 22 Left 1152922752 17:83073968-83073990 CCCATCTGACCCTGGGCGGTCCC No data
Right 1152922764 17:83074013-83074035 TGACAAGGCCTTGCCTCCTTCGG No data
1152922752_1152922765 23 Left 1152922752 17:83073968-83073990 CCCATCTGACCCTGGGCGGTCCC No data
Right 1152922765 17:83074014-83074036 GACAAGGCCTTGCCTCCTTCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152922752 Original CRISPR GGGACCGCCCAGGGTCAGAT GGG (reversed) Intergenic