ID: 1152922753

View in Genome Browser
Species Human (GRCh38)
Location 17:83073969-83073991
Sequence GGGGACCGCCCAGGGTCAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152922753_1152922767 26 Left 1152922753 17:83073969-83073991 CCATCTGACCCTGGGCGGTCCCC No data
Right 1152922767 17:83074018-83074040 AGGCCTTGCCTCCTTCGGGGTGG No data
1152922753_1152922765 22 Left 1152922753 17:83073969-83073991 CCATCTGACCCTGGGCGGTCCCC No data
Right 1152922765 17:83074014-83074036 GACAAGGCCTTGCCTCCTTCGGG No data
1152922753_1152922766 23 Left 1152922753 17:83073969-83073991 CCATCTGACCCTGGGCGGTCCCC No data
Right 1152922766 17:83074015-83074037 ACAAGGCCTTGCCTCCTTCGGGG No data
1152922753_1152922764 21 Left 1152922753 17:83073969-83073991 CCATCTGACCCTGGGCGGTCCCC No data
Right 1152922764 17:83074013-83074035 TGACAAGGCCTTGCCTCCTTCGG No data
1152922753_1152922763 6 Left 1152922753 17:83073969-83073991 CCATCTGACCCTGGGCGGTCCCC No data
Right 1152922763 17:83073998-83074020 CGGCTTAACAGATGTTGACAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152922753 Original CRISPR GGGGACCGCCCAGGGTCAGA TGG (reversed) Intergenic
No off target data available for this crispr