ID: 1152922755

View in Genome Browser
Species Human (GRCh38)
Location 17:83073977-83073999
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152922755_1152922766 15 Left 1152922755 17:83073977-83073999 CCCTGGGCGGTCCCCGGTTCCCG No data
Right 1152922766 17:83074015-83074037 ACAAGGCCTTGCCTCCTTCGGGG No data
1152922755_1152922765 14 Left 1152922755 17:83073977-83073999 CCCTGGGCGGTCCCCGGTTCCCG No data
Right 1152922765 17:83074014-83074036 GACAAGGCCTTGCCTCCTTCGGG No data
1152922755_1152922769 25 Left 1152922755 17:83073977-83073999 CCCTGGGCGGTCCCCGGTTCCCG No data
Right 1152922769 17:83074025-83074047 GCCTCCTTCGGGGTGGTGCCAGG No data
1152922755_1152922763 -2 Left 1152922755 17:83073977-83073999 CCCTGGGCGGTCCCCGGTTCCCG No data
Right 1152922763 17:83073998-83074020 CGGCTTAACAGATGTTGACAAGG No data
1152922755_1152922767 18 Left 1152922755 17:83073977-83073999 CCCTGGGCGGTCCCCGGTTCCCG No data
Right 1152922767 17:83074018-83074040 AGGCCTTGCCTCCTTCGGGGTGG No data
1152922755_1152922764 13 Left 1152922755 17:83073977-83073999 CCCTGGGCGGTCCCCGGTTCCCG No data
Right 1152922764 17:83074013-83074035 TGACAAGGCCTTGCCTCCTTCGG No data
1152922755_1152922772 27 Left 1152922755 17:83073977-83073999 CCCTGGGCGGTCCCCGGTTCCCG No data
Right 1152922772 17:83074027-83074049 CTCCTTCGGGGTGGTGCCAGGGG No data
1152922755_1152922771 26 Left 1152922755 17:83073977-83073999 CCCTGGGCGGTCCCCGGTTCCCG No data
Right 1152922771 17:83074026-83074048 CCTCCTTCGGGGTGGTGCCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152922755 Original CRISPR CGGGAACCGGGGACCGCCCA GGG (reversed) Intergenic