ID: 1152922756

View in Genome Browser
Species Human (GRCh38)
Location 17:83073978-83074000
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152922756_1152922764 12 Left 1152922756 17:83073978-83074000 CCTGGGCGGTCCCCGGTTCCCGG No data
Right 1152922764 17:83074013-83074035 TGACAAGGCCTTGCCTCCTTCGG No data
1152922756_1152922765 13 Left 1152922756 17:83073978-83074000 CCTGGGCGGTCCCCGGTTCCCGG No data
Right 1152922765 17:83074014-83074036 GACAAGGCCTTGCCTCCTTCGGG No data
1152922756_1152922769 24 Left 1152922756 17:83073978-83074000 CCTGGGCGGTCCCCGGTTCCCGG No data
Right 1152922769 17:83074025-83074047 GCCTCCTTCGGGGTGGTGCCAGG No data
1152922756_1152922766 14 Left 1152922756 17:83073978-83074000 CCTGGGCGGTCCCCGGTTCCCGG No data
Right 1152922766 17:83074015-83074037 ACAAGGCCTTGCCTCCTTCGGGG No data
1152922756_1152922763 -3 Left 1152922756 17:83073978-83074000 CCTGGGCGGTCCCCGGTTCCCGG No data
Right 1152922763 17:83073998-83074020 CGGCTTAACAGATGTTGACAAGG No data
1152922756_1152922767 17 Left 1152922756 17:83073978-83074000 CCTGGGCGGTCCCCGGTTCCCGG No data
Right 1152922767 17:83074018-83074040 AGGCCTTGCCTCCTTCGGGGTGG No data
1152922756_1152922772 26 Left 1152922756 17:83073978-83074000 CCTGGGCGGTCCCCGGTTCCCGG No data
Right 1152922772 17:83074027-83074049 CTCCTTCGGGGTGGTGCCAGGGG No data
1152922756_1152922771 25 Left 1152922756 17:83073978-83074000 CCTGGGCGGTCCCCGGTTCCCGG No data
Right 1152922771 17:83074026-83074048 CCTCCTTCGGGGTGGTGCCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152922756 Original CRISPR CCGGGAACCGGGGACCGCCC AGG (reversed) Intergenic
No off target data available for this crispr