ID: 1152922759

View in Genome Browser
Species Human (GRCh38)
Location 17:83073989-83074011
Sequence CATCTGTTAAGCCGGGAACC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152922759_1152922769 13 Left 1152922759 17:83073989-83074011 CCCGGTTCCCGGCTTAACAGATG No data
Right 1152922769 17:83074025-83074047 GCCTCCTTCGGGGTGGTGCCAGG No data
1152922759_1152922776 23 Left 1152922759 17:83073989-83074011 CCCGGTTCCCGGCTTAACAGATG No data
Right 1152922776 17:83074035-83074057 GGGTGGTGCCAGGGGCAGAGGGG No data
1152922759_1152922766 3 Left 1152922759 17:83073989-83074011 CCCGGTTCCCGGCTTAACAGATG No data
Right 1152922766 17:83074015-83074037 ACAAGGCCTTGCCTCCTTCGGGG No data
1152922759_1152922771 14 Left 1152922759 17:83073989-83074011 CCCGGTTCCCGGCTTAACAGATG No data
Right 1152922771 17:83074026-83074048 CCTCCTTCGGGGTGGTGCCAGGG No data
1152922759_1152922775 22 Left 1152922759 17:83073989-83074011 CCCGGTTCCCGGCTTAACAGATG No data
Right 1152922775 17:83074034-83074056 GGGGTGGTGCCAGGGGCAGAGGG No data
1152922759_1152922767 6 Left 1152922759 17:83073989-83074011 CCCGGTTCCCGGCTTAACAGATG No data
Right 1152922767 17:83074018-83074040 AGGCCTTGCCTCCTTCGGGGTGG No data
1152922759_1152922765 2 Left 1152922759 17:83073989-83074011 CCCGGTTCCCGGCTTAACAGATG No data
Right 1152922765 17:83074014-83074036 GACAAGGCCTTGCCTCCTTCGGG No data
1152922759_1152922772 15 Left 1152922759 17:83073989-83074011 CCCGGTTCCCGGCTTAACAGATG No data
Right 1152922772 17:83074027-83074049 CTCCTTCGGGGTGGTGCCAGGGG No data
1152922759_1152922764 1 Left 1152922759 17:83073989-83074011 CCCGGTTCCCGGCTTAACAGATG No data
Right 1152922764 17:83074013-83074035 TGACAAGGCCTTGCCTCCTTCGG No data
1152922759_1152922774 21 Left 1152922759 17:83073989-83074011 CCCGGTTCCCGGCTTAACAGATG No data
Right 1152922774 17:83074033-83074055 CGGGGTGGTGCCAGGGGCAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152922759 Original CRISPR CATCTGTTAAGCCGGGAACC GGG (reversed) Intergenic