ID: 1152922766

View in Genome Browser
Species Human (GRCh38)
Location 17:83074015-83074037
Sequence ACAAGGCCTTGCCTCCTTCG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152922750_1152922766 28 Left 1152922750 17:83073964-83073986 CCAGCCCATCTGACCCTGGGCGG No data
Right 1152922766 17:83074015-83074037 ACAAGGCCTTGCCTCCTTCGGGG No data
1152922756_1152922766 14 Left 1152922756 17:83073978-83074000 CCTGGGCGGTCCCCGGTTCCCGG No data
Right 1152922766 17:83074015-83074037 ACAAGGCCTTGCCTCCTTCGGGG No data
1152922755_1152922766 15 Left 1152922755 17:83073977-83073999 CCCTGGGCGGTCCCCGGTTCCCG No data
Right 1152922766 17:83074015-83074037 ACAAGGCCTTGCCTCCTTCGGGG No data
1152922752_1152922766 24 Left 1152922752 17:83073968-83073990 CCCATCTGACCCTGGGCGGTCCC No data
Right 1152922766 17:83074015-83074037 ACAAGGCCTTGCCTCCTTCGGGG No data
1152922759_1152922766 3 Left 1152922759 17:83073989-83074011 CCCGGTTCCCGGCTTAACAGATG No data
Right 1152922766 17:83074015-83074037 ACAAGGCCTTGCCTCCTTCGGGG No data
1152922758_1152922766 4 Left 1152922758 17:83073988-83074010 CCCCGGTTCCCGGCTTAACAGAT No data
Right 1152922766 17:83074015-83074037 ACAAGGCCTTGCCTCCTTCGGGG No data
1152922761_1152922766 -4 Left 1152922761 17:83073996-83074018 CCCGGCTTAACAGATGTTGACAA No data
Right 1152922766 17:83074015-83074037 ACAAGGCCTTGCCTCCTTCGGGG No data
1152922753_1152922766 23 Left 1152922753 17:83073969-83073991 CCATCTGACCCTGGGCGGTCCCC No data
Right 1152922766 17:83074015-83074037 ACAAGGCCTTGCCTCCTTCGGGG No data
1152922760_1152922766 2 Left 1152922760 17:83073990-83074012 CCGGTTCCCGGCTTAACAGATGT No data
Right 1152922766 17:83074015-83074037 ACAAGGCCTTGCCTCCTTCGGGG No data
1152922762_1152922766 -5 Left 1152922762 17:83073997-83074019 CCGGCTTAACAGATGTTGACAAG No data
Right 1152922766 17:83074015-83074037 ACAAGGCCTTGCCTCCTTCGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152922766 Original CRISPR ACAAGGCCTTGCCTCCTTCG GGG Intergenic
No off target data available for this crispr