ID: 1152922768

View in Genome Browser
Species Human (GRCh38)
Location 17:83074021-83074043
Sequence GCACCACCCCGAAGGAGGCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152922768_1152922779 7 Left 1152922768 17:83074021-83074043 CCTTGCCTCCTTCGGGGTGGTGC No data
Right 1152922779 17:83074051-83074073 AGAGGGGCACAGCAAGAACAGGG No data
1152922768_1152922778 6 Left 1152922768 17:83074021-83074043 CCTTGCCTCCTTCGGGGTGGTGC No data
Right 1152922778 17:83074050-83074072 CAGAGGGGCACAGCAAGAACAGG No data
1152922768_1152922776 -9 Left 1152922768 17:83074021-83074043 CCTTGCCTCCTTCGGGGTGGTGC No data
Right 1152922776 17:83074035-83074057 GGGTGGTGCCAGGGGCAGAGGGG No data
1152922768_1152922775 -10 Left 1152922768 17:83074021-83074043 CCTTGCCTCCTTCGGGGTGGTGC No data
Right 1152922775 17:83074034-83074056 GGGGTGGTGCCAGGGGCAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152922768 Original CRISPR GCACCACCCCGAAGGAGGCA AGG (reversed) Intergenic
No off target data available for this crispr