ID: 1152922770 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 17:83074026-83074048 |
| Sequence | CCCTGGCACCACCCCGAAGG AGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1152922770_1152922778 | 1 | Left | 1152922770 | 17:83074026-83074048 | CCTCCTTCGGGGTGGTGCCAGGG | No data | ||
| Right | 1152922778 | 17:83074050-83074072 | CAGAGGGGCACAGCAAGAACAGG | No data | ||||
| 1152922770_1152922779 | 2 | Left | 1152922770 | 17:83074026-83074048 | CCTCCTTCGGGGTGGTGCCAGGG | No data | ||
| Right | 1152922779 | 17:83074051-83074073 | AGAGGGGCACAGCAAGAACAGGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1152922770 | Original CRISPR | CCCTGGCACCACCCCGAAGG AGG (reversed) | Intergenic | ||