ID: 1152922771

View in Genome Browser
Species Human (GRCh38)
Location 17:83074026-83074048
Sequence CCTCCTTCGGGGTGGTGCCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152922760_1152922771 13 Left 1152922760 17:83073990-83074012 CCGGTTCCCGGCTTAACAGATGT No data
Right 1152922771 17:83074026-83074048 CCTCCTTCGGGGTGGTGCCAGGG No data
1152922762_1152922771 6 Left 1152922762 17:83073997-83074019 CCGGCTTAACAGATGTTGACAAG No data
Right 1152922771 17:83074026-83074048 CCTCCTTCGGGGTGGTGCCAGGG No data
1152922755_1152922771 26 Left 1152922755 17:83073977-83073999 CCCTGGGCGGTCCCCGGTTCCCG No data
Right 1152922771 17:83074026-83074048 CCTCCTTCGGGGTGGTGCCAGGG No data
1152922759_1152922771 14 Left 1152922759 17:83073989-83074011 CCCGGTTCCCGGCTTAACAGATG No data
Right 1152922771 17:83074026-83074048 CCTCCTTCGGGGTGGTGCCAGGG No data
1152922756_1152922771 25 Left 1152922756 17:83073978-83074000 CCTGGGCGGTCCCCGGTTCCCGG No data
Right 1152922771 17:83074026-83074048 CCTCCTTCGGGGTGGTGCCAGGG No data
1152922758_1152922771 15 Left 1152922758 17:83073988-83074010 CCCCGGTTCCCGGCTTAACAGAT No data
Right 1152922771 17:83074026-83074048 CCTCCTTCGGGGTGGTGCCAGGG No data
1152922761_1152922771 7 Left 1152922761 17:83073996-83074018 CCCGGCTTAACAGATGTTGACAA No data
Right 1152922771 17:83074026-83074048 CCTCCTTCGGGGTGGTGCCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152922771 Original CRISPR CCTCCTTCGGGGTGGTGCCA GGG Intergenic
No off target data available for this crispr