ID: 1152922773

View in Genome Browser
Species Human (GRCh38)
Location 17:83074029-83074051
Sequence TGCCCCTGGCACCACCCCGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152922773_1152922778 -2 Left 1152922773 17:83074029-83074051 CCTTCGGGGTGGTGCCAGGGGCA No data
Right 1152922778 17:83074050-83074072 CAGAGGGGCACAGCAAGAACAGG No data
1152922773_1152922779 -1 Left 1152922773 17:83074029-83074051 CCTTCGGGGTGGTGCCAGGGGCA No data
Right 1152922779 17:83074051-83074073 AGAGGGGCACAGCAAGAACAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152922773 Original CRISPR TGCCCCTGGCACCACCCCGA AGG (reversed) Intergenic