ID: 1152922775

View in Genome Browser
Species Human (GRCh38)
Location 17:83074034-83074056
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152922759_1152922775 22 Left 1152922759 17:83073989-83074011 CCCGGTTCCCGGCTTAACAGATG No data
Right 1152922775 17:83074034-83074056 GGGGTGGTGCCAGGGGCAGAGGG No data
1152922762_1152922775 14 Left 1152922762 17:83073997-83074019 CCGGCTTAACAGATGTTGACAAG No data
Right 1152922775 17:83074034-83074056 GGGGTGGTGCCAGGGGCAGAGGG No data
1152922758_1152922775 23 Left 1152922758 17:83073988-83074010 CCCCGGTTCCCGGCTTAACAGAT No data
Right 1152922775 17:83074034-83074056 GGGGTGGTGCCAGGGGCAGAGGG No data
1152922760_1152922775 21 Left 1152922760 17:83073990-83074012 CCGGTTCCCGGCTTAACAGATGT No data
Right 1152922775 17:83074034-83074056 GGGGTGGTGCCAGGGGCAGAGGG No data
1152922768_1152922775 -10 Left 1152922768 17:83074021-83074043 CCTTGCCTCCTTCGGGGTGGTGC No data
Right 1152922775 17:83074034-83074056 GGGGTGGTGCCAGGGGCAGAGGG No data
1152922761_1152922775 15 Left 1152922761 17:83073996-83074018 CCCGGCTTAACAGATGTTGACAA No data
Right 1152922775 17:83074034-83074056 GGGGTGGTGCCAGGGGCAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152922775 Original CRISPR GGGGTGGTGCCAGGGGCAGA GGG Intergenic