ID: 1152922778

View in Genome Browser
Species Human (GRCh38)
Location 17:83074050-83074072
Sequence CAGAGGGGCACAGCAAGAAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152922770_1152922778 1 Left 1152922770 17:83074026-83074048 CCTCCTTCGGGGTGGTGCCAGGG No data
Right 1152922778 17:83074050-83074072 CAGAGGGGCACAGCAAGAACAGG No data
1152922773_1152922778 -2 Left 1152922773 17:83074029-83074051 CCTTCGGGGTGGTGCCAGGGGCA No data
Right 1152922778 17:83074050-83074072 CAGAGGGGCACAGCAAGAACAGG No data
1152922762_1152922778 30 Left 1152922762 17:83073997-83074019 CCGGCTTAACAGATGTTGACAAG No data
Right 1152922778 17:83074050-83074072 CAGAGGGGCACAGCAAGAACAGG No data
1152922768_1152922778 6 Left 1152922768 17:83074021-83074043 CCTTGCCTCCTTCGGGGTGGTGC No data
Right 1152922778 17:83074050-83074072 CAGAGGGGCACAGCAAGAACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152922778 Original CRISPR CAGAGGGGCACAGCAAGAAC AGG Intergenic