ID: 1152924276

View in Genome Browser
Species Human (GRCh38)
Location 17:83080212-83080234
Sequence CGCCTGCAGCGCGGCCGGGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 151
Summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 135}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152924263_1152924276 6 Left 1152924263 17:83080183-83080205 CCCGGCCCGGAGGACGCCCGGGG 0: 1
1: 0
2: 2
3: 26
4: 227
Right 1152924276 17:83080212-83080234 CGCCTGCAGCGCGGCCGGGTGGG 0: 1
1: 0
2: 1
3: 14
4: 135
1152924259_1152924276 13 Left 1152924259 17:83080176-83080198 CCCGGTTCCCGGCCCGGAGGACG 0: 1
1: 0
2: 0
3: 6
4: 85
Right 1152924276 17:83080212-83080234 CGCCTGCAGCGCGGCCGGGTGGG 0: 1
1: 0
2: 1
3: 14
4: 135
1152924265_1152924276 5 Left 1152924265 17:83080184-83080206 CCGGCCCGGAGGACGCCCGGGGG 0: 1
1: 0
2: 0
3: 23
4: 165
Right 1152924276 17:83080212-83080234 CGCCTGCAGCGCGGCCGGGTGGG 0: 1
1: 0
2: 1
3: 14
4: 135
1152924256_1152924276 22 Left 1152924256 17:83080167-83080189 CCGCGGCGTCCCGGTTCCCGGCC 0: 1
1: 0
2: 2
3: 9
4: 180
Right 1152924276 17:83080212-83080234 CGCCTGCAGCGCGGCCGGGTGGG 0: 1
1: 0
2: 1
3: 14
4: 135
1152924260_1152924276 12 Left 1152924260 17:83080177-83080199 CCGGTTCCCGGCCCGGAGGACGC 0: 1
1: 0
2: 1
3: 6
4: 85
Right 1152924276 17:83080212-83080234 CGCCTGCAGCGCGGCCGGGTGGG 0: 1
1: 0
2: 1
3: 14
4: 135
1152924268_1152924276 1 Left 1152924268 17:83080188-83080210 CCCGGAGGACGCCCGGGGGAGGC 0: 1
1: 0
2: 1
3: 20
4: 218
Right 1152924276 17:83080212-83080234 CGCCTGCAGCGCGGCCGGGTGGG 0: 1
1: 0
2: 1
3: 14
4: 135
1152924270_1152924276 -10 Left 1152924270 17:83080199-83080221 CCCGGGGGAGGCGCGCCTGCAGC 0: 1
1: 1
2: 1
3: 39
4: 281
Right 1152924276 17:83080212-83080234 CGCCTGCAGCGCGGCCGGGTGGG 0: 1
1: 0
2: 1
3: 14
4: 135
1152924269_1152924276 0 Left 1152924269 17:83080189-83080211 CCGGAGGACGCCCGGGGGAGGCG 0: 1
1: 0
2: 1
3: 15
4: 169
Right 1152924276 17:83080212-83080234 CGCCTGCAGCGCGGCCGGGTGGG 0: 1
1: 0
2: 1
3: 14
4: 135
1152924255_1152924276 23 Left 1152924255 17:83080166-83080188 CCCGCGGCGTCCCGGTTCCCGGC 0: 1
1: 0
2: 2
3: 6
4: 121
Right 1152924276 17:83080212-83080234 CGCCTGCAGCGCGGCCGGGTGGG 0: 1
1: 0
2: 1
3: 14
4: 135

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152924276 Original CRISPR CGCCTGCAGCGCGGCCGGGT GGG Intronic
900113775 1:1020186-1020208 CGGCCGCAGCGGGCCCGGGTGGG - Exonic
900661464 1:3786568-3786590 CGCCTGCACCCTGGCCTGGTTGG - Intronic
902044181 1:13513063-13513085 CGCGGGCAGCGCGGCCAGGGCGG + Exonic
903068994 1:20717444-20717466 CGCCTGCAGGGCGGCCTGCCGGG + Intronic
905416426 1:37807758-37807780 CGCCCCTAGCGGGGCCGGGTCGG + Intronic
912568789 1:110607139-110607161 AGCCTGCAGCGCAGCAGGCTTGG - Intronic
912681086 1:111729504-111729526 AGGCTGCAGCGGGGCGGGGTGGG + Intronic
912715845 1:111982988-111983010 CTCCTGGAGCTCGGCAGGGTGGG + Intronic
915938632 1:160104181-160104203 AGCCTGCAGCGCGGCAGGCATGG - Intergenic
918525779 1:185463310-185463332 CGTCTGCAGCTCGCCCTGGTAGG + Intergenic
919927427 1:202199491-202199513 GGCATGGGGCGCGGCCGGGTGGG + Intronic
920528412 1:206685083-206685105 AGCCTGGAGCCGGGCCGGGTCGG + Exonic
921565329 1:216710777-216710799 CGCATGCAGTGCAGCGGGGTGGG - Intronic
922730790 1:227947964-227947986 CGCCCGGAGCGCGGCCAGCTGGG + Intergenic
922775455 1:228212424-228212446 CGCCAGGAGCGCGGCCGTGGAGG - Exonic
1065140550 10:22714731-22714753 CGGCTGCAGCGGAGCCGGGGCGG - Intergenic
1065636907 10:27743177-27743199 CGCCTGCGGCCCGGAGGGGTGGG - Intronic
1067061027 10:43077957-43077979 CGACTCCAGGGCTGCCGGGTGGG - Intronic
1068605635 10:59002268-59002290 CACCTGCAGCTGGGCCAGGTAGG - Intergenic
1072971307 10:100020139-100020161 CACCTGCAGCAGGGCCTGGTGGG + Intergenic
1074065466 10:110008559-110008581 GGCCTGCGGCGCCGCCGGGTGGG + Intronic
1077058700 11:608371-608393 AGCCTGCAGCACGTCCGGGCTGG - Exonic
1077409124 11:2395342-2395364 CGCCTGGGGCGGGGCGGGGTGGG + Intronic
1079451754 11:20604446-20604468 CGCCTGCGGCGGGGCGGGGCGGG + Intronic
1083672160 11:64305708-64305730 CTCCGGCAGCGCGGTCGGGCAGG - Intronic
1083673739 11:64314244-64314266 CGCCTGGACCGCGTCCGGGGTGG + Exonic
1083741409 11:64713391-64713413 CAGCTGCAGCGTGGCCGGCTCGG + Exonic
1084070086 11:66728226-66728248 CGCCTGCAGCCCGGCCGCGACGG + Intronic
1086981078 11:93198055-93198077 GGACTGCTGCGAGGCCGGGTTGG + Intergenic
1087761729 11:102110324-102110346 CGCCCGCACCGCGGCCCGGCCGG - Intergenic
1089556161 11:119316946-119316968 AGCCAGCGGCGCGGCGGGGTCGG - Intronic
1090042301 11:123301820-123301842 CGCCCGGGGGGCGGCCGGGTTGG - Intergenic
1091227687 11:133967411-133967433 CGCCTGTAGCCCGGGCGGGTGGG - Intergenic
1091238466 11:134037015-134037037 CGTCTGCAGCGAGGCGGGGCTGG - Intergenic
1091780958 12:3214445-3214467 TGCCTGCCGCGGGGCTGGGTCGG + Intronic
1100831001 12:98516288-98516310 CGCCTGCAGCCCCGCGGGGAAGG - Intronic
1102269144 12:111516246-111516268 GGCCTGGAGGGCGGCCGTGTAGG + Exonic
1103326565 12:120125267-120125289 AGCCTGCAGAGCAGCTGGGTAGG + Intergenic
1103350808 12:120282300-120282322 AGCATGCAGTGCGGCCTGGTGGG + Intergenic
1104950885 12:132439398-132439420 GGCCGGCAGCGGGGCCGTGTTGG - Intergenic
1105344518 13:19560808-19560830 CGCCTGGACCGCGTCCGGGGTGG - Intergenic
1105535516 13:21260764-21260786 CGCCTGGATCGCGTCCGGGGTGG + Intergenic
1105896143 13:24718664-24718686 GGCCTGCAGCGCGGCTGTGAGGG + Intergenic
1107831083 13:44374140-44374162 GCCCTGCAGCCCGGCGGGGTGGG + Intronic
1116928578 14:50667911-50667933 CCCCTGCACCTCGGCCGGCTTGG + Exonic
1120190617 14:81436399-81436421 CGAGAGCAGTGCGGCCGGGTGGG - Intronic
1122162330 14:99793426-99793448 CGGCGGCGGCGCGGCCGGGCCGG + Exonic
1122486633 14:102086686-102086708 CGCCCCCAGCGGGGCCGGGCGGG + Intronic
1122550030 14:102544682-102544704 CTCCTGCTGCGCGGCCGGGGAGG + Intergenic
1124501020 15:30226010-30226032 CGCGTGGACCGGGGCCGGGTCGG - Intergenic
1124742549 15:32312657-32312679 CGCGTGGACCGGGGCCGGGTCGG + Intergenic
1125514224 15:40308898-40308920 AGCCTGCAGCGGGGCTGGGGCGG + Intergenic
1130178956 15:81606135-81606157 CGCCTGCAGCTGGGCAGGATTGG + Intergenic
1132598693 16:764489-764511 CGCCTGCAGCGCTGCCCTGGGGG - Intronic
1132875479 16:2135238-2135260 CGTCTGCAGAGCCCCCGGGTGGG + Intronic
1136566464 16:31073524-31073546 CGCGAGCAGCGCGGGCGGGGCGG - Intronic
1136630667 16:31487777-31487799 CGCCTGCAGTGAGGCCGGGGCGG + Intronic
1140480020 16:75257319-75257341 CCCCAGCAGAGTGGCCGGGTGGG - Intronic
1140927614 16:79599275-79599297 CGCGGGCAGCGCGGCCGCCTCGG - Exonic
1141642423 16:85348974-85348996 CGGCTGCAGCGCTCCCGGCTGGG - Intergenic
1141644569 16:85360352-85360374 CCCCTGCCCTGCGGCCGGGTGGG + Intergenic
1142595388 17:1027264-1027286 GGCCTGCAGGGAGGCCGGGGAGG + Intronic
1142670588 17:1485860-1485882 CGCCTCCCGCGCGGCCGGGCTGG + Intronic
1143527217 17:7479586-7479608 CGGCGGCAGCGGGGCCGGGCCGG - Intronic
1143528187 17:7484375-7484397 CGCCGAGAGCGCGGCCGGGACGG + Exonic
1145062831 17:19743505-19743527 CGCCTGCAGCTGGGGCGAGTGGG + Intronic
1147581975 17:41632087-41632109 TGCGTGCTGCGCGGCGGGGTTGG + Intergenic
1147603252 17:41758808-41758830 CTCCTGCAGCGGGGCATGGTTGG + Exonic
1147671849 17:42180982-42181004 AGCTTTCAGCGCGGCCGGGCCGG + Exonic
1148107539 17:45127410-45127432 CACCTGCAGCCCGGGCGGTTTGG + Intronic
1148936376 17:51166873-51166895 GGCGTGCAGCGCGGCCTGGTGGG + Exonic
1151785153 17:76271780-76271802 CGCCTGCAGGGCTGCGGGGAAGG - Intergenic
1152321274 17:79609972-79609994 CTCGAGCAGCGCGGCCGGGCTGG - Intergenic
1152586238 17:81190674-81190696 GGCCTGCAGCGTGGCCAGCTCGG + Exonic
1152900952 17:82940850-82940872 CTCCTCCAGCGAGGCTGGGTCGG + Intronic
1152924276 17:83080212-83080234 CGCCTGCAGCGCGGCCGGGTGGG + Intronic
1155611724 18:27674140-27674162 CGCATTCCGAGCGGCCGGGTGGG - Intergenic
1156350636 18:36298294-36298316 CGCCGTTAGCTCGGCCGGGTGGG + Intronic
1161060263 19:2211183-2211205 CTTCTGCAGCGCGGGCGGGGTGG - Exonic
1161290572 19:3491621-3491643 AGCCTGCAGCGCGGCCAGGCAGG + Exonic
1162392016 19:10395590-10395612 CGCCTCGAGCGCGGCCGGGCGGG + Intronic
1164919602 19:32079007-32079029 CGGCTGCAGGGGGGCTGGGTGGG - Intergenic
1165349809 19:35269341-35269363 GGCCTCAGGCGCGGCCGGGTGGG + Intronic
1166735109 19:45079387-45079409 CGCCTGCAGCGCCGGCTGGAGGG + Intronic
1166863083 19:45820940-45820962 TGCCTGCAGGGCGGCAGGGTTGG - Intronic
927653826 2:24928820-24928842 GGCCTGCAGCCTGGCCGGGAAGG + Intergenic
927720104 2:25376982-25377004 CGCCTGCAGCCCGGGAGGGAGGG - Intergenic
929172465 2:38945551-38945573 GGCCTGCAGCGCAGCTGGGAGGG - Intronic
941580692 2:167293115-167293137 CGCCGGCGGCGCGGCGGGGTGGG - Intergenic
946422111 2:219570956-219570978 CGCCCGCAACGCGGCCGGCGAGG - Exonic
946843122 2:223837350-223837372 GGCCGGGCGCGCGGCCGGGTGGG - Intronic
948841391 2:240651333-240651355 CACCTGCAGCACGGCCAGCTGGG - Intergenic
1169204565 20:3732597-3732619 CGCCGCCTGCGCCGCCGGGTCGG - Intergenic
1171459458 20:25290736-25290758 CGCCTGCAGCCCGGCTGGCTAGG - Intronic
1172607728 20:36225836-36225858 AGACTGCATCGCGGCGGGGTGGG - Intronic
1175220904 20:57415919-57415941 AGCCTGCAGCGGGGTGGGGTTGG + Intergenic
1175606664 20:60316947-60316969 AGCCTGCTGCGGGGCCGGATGGG - Intergenic
1176048051 20:63102809-63102831 GGCGCGCAGCGGGGCCGGGTGGG - Intergenic
1181945344 22:26512560-26512582 TGGCTGCAGAGCGGCCGGCTGGG + Intergenic
954194898 3:48990622-48990644 GGCCTGGAGCGCGGCGGGGCAGG - Intronic
958195246 3:90235439-90235461 CTCTTGCAGCCAGGCCGGGTGGG + Intergenic
958959122 3:100492394-100492416 CGGCGGCTGCGCGGCCGGGACGG - Intergenic
963044618 3:141093626-141093648 CTTCTGCAGCGCCGCAGGGTGGG - Intronic
967100715 3:186213304-186213326 AGCCTGCAGAGCAGCCAGGTGGG + Intronic
968470830 4:781615-781637 AGCCCGCAGCGGGGCCGGGCAGG + Intergenic
968515078 4:1012342-1012364 CGCCTGGAGCGCGGGCGGGGAGG + Intronic
968651966 4:1763733-1763755 CGCCGGCAGCGAGGCTGGGCAGG + Intergenic
968746706 4:2364225-2364247 GGTCTGCAGCCAGGCCGGGTGGG - Intronic
968803144 4:2756119-2756141 CCCCTCCAGCGCGGCCAGGCGGG + Exonic
969559735 4:7939489-7939511 CGCCTGCTGCGACGCCGCGTGGG - Exonic
969619093 4:8269955-8269977 CGCCTGCATGGCGGCAGGGCCGG - Exonic
969619161 4:8270261-8270283 CGCCTGCAGCGCGCACACGTTGG - Exonic
969629180 4:8325579-8325601 GGCCTGCAGTGCGGACAGGTTGG - Intergenic
972396440 4:38663456-38663478 CTCCTGCACCGCGGCCGCCTCGG + Intergenic
976199087 4:82561782-82561804 GGGCTGCAGCGCGGCTGGGGCGG - Intronic
981366633 4:143911997-143912019 CCCCTGCACCTCGGCCGGCTTGG + Intergenic
985895721 5:2749167-2749189 CGCCTGTCACGTGGCCGGGTGGG - Intronic
985896402 5:2751952-2751974 GGCACGCAGCGCGGCCGGGCTGG - Intergenic
987099808 5:14581876-14581898 CGTCCGCAGCGCGGCCGGCATGG + Exonic
989011589 5:36877393-36877415 CTCCTGCTGGGCGGCCGGGGAGG + Intronic
990041501 5:51383085-51383107 CGCAGGCGGCGCGGCCGGGAAGG + Intergenic
992473126 5:77077297-77077319 CGCCTGCAGCGCCTCCCGCTCGG + Exonic
1002580870 5:180208933-180208955 TGCCGGCGGCGCGGCGGGGTCGG - Intronic
1002664018 5:180809987-180810009 CGTCCGCAGGGCGGACGGGTGGG - Intronic
1006122708 6:31816865-31816887 CGCCTGCACCGCCGCCCCGTAGG - Exonic
1006124571 6:31829059-31829081 CGCCTGCACCGCCGCCCCGTAGG - Exonic
1006516779 6:34549828-34549850 CTCCTGCAGTGAGGCCGGCTGGG - Intronic
1017738085 6:157381537-157381559 CTTCTGCGGCGCGGCCAGGTTGG - Exonic
1017954423 6:159167244-159167266 CGCATGGAGAGCGGCCAGGTGGG - Intergenic
1019273543 7:164085-164107 CGCGTGCAGGTCGGCTGGGTGGG - Intergenic
1019989475 7:4682014-4682036 CGCCTGCAGCCCCGCGGGGAGGG + Intergenic
1020106503 7:5424516-5424538 CCCCAGCAGCGCGGTCGGGTGGG + Intronic
1021015495 7:15526152-15526174 CTCCTGCAGCGAACCCGGGTGGG + Intronic
1022105972 7:27198654-27198676 CTCCTGCAGGATGGCCGGGTTGG - Intronic
1022113081 7:27243249-27243271 CGCAGGCAGCGCGGCGGGGCCGG + Exonic
1030960699 7:115917732-115917754 TGCCTGCAGGGCGGAGGGGTGGG + Intergenic
1032077951 7:128844955-128844977 GGCCTGGAGCGCGGCAAGGTCGG + Exonic
1032391132 7:131556186-131556208 TCCCTGCAGCTCGGCCGGGCAGG + Intronic
1035435658 7:158857052-158857074 CCCCTGCTGCGGGGCCGGGGTGG + Intronic
1041072045 8:54135177-54135199 CGGCTGCAGCGCGACAGGGGCGG + Intergenic
1045510069 8:102806891-102806913 GGCCTGCCGCGCGGCCCGGGGGG + Intergenic
1048987436 8:139742262-139742284 CGCCGGCAGCATGGCCGGTTGGG - Intronic
1049694306 8:143976133-143976155 CTGCTGCAGCGAGGCCGGGAGGG + Intronic
1051404920 9:16727046-16727068 CGCCTCCAGCGCGGCCGGGACGG + Intronic
1057716583 9:97501217-97501239 TCCCAGCAGCGCGGCCAGGTGGG - Intronic
1058053300 9:100427293-100427315 CGCAAGCAGGGCGGCCGGGAGGG - Intronic
1060468734 9:123930165-123930187 CGGCGGCAGCGCGGGCGGGAGGG - Intergenic
1062440057 9:136565802-136565824 CCCCTGCAGGACGGCCGGGGTGG - Intergenic
1062462056 9:136666189-136666211 AGCCAGCAGCGCGGCTGGGAGGG + Intronic
1187459636 X:19475386-19475408 CTCCTGCTGTGCGGCCCGGTCGG + Intronic
1189821486 X:44873384-44873406 CGCCTTCACCGCCGCCGCGTTGG + Intronic