ID: 1152925796

View in Genome Browser
Species Human (GRCh38)
Location 17:83087243-83087265
Sequence CGGTTTAAGCAGATGCCGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 40
Summary {0: 1, 1: 0, 2: 1, 3: 2, 4: 36}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152925796_1152925809 28 Left 1152925796 17:83087243-83087265 CCCTGCGGCATCTGCTTAAACCG 0: 1
1: 0
2: 1
3: 2
4: 36
Right 1152925809 17:83087294-83087316 GGTGGTGGGTTGCTTATCCGAGG 0: 1
1: 0
2: 0
3: 4
4: 58
1152925796_1152925802 7 Left 1152925796 17:83087243-83087265 CCCTGCGGCATCTGCTTAAACCG 0: 1
1: 0
2: 1
3: 2
4: 36
Right 1152925802 17:83087273-83087295 GGTGATTTCCAGTGCCCTGTGGG 0: 1
1: 0
2: 1
3: 13
4: 177
1152925796_1152925805 14 Left 1152925796 17:83087243-83087265 CCCTGCGGCATCTGCTTAAACCG 0: 1
1: 0
2: 1
3: 2
4: 36
Right 1152925805 17:83087280-83087302 TCCAGTGCCCTGTGGGTGGTGGG 0: 1
1: 0
2: 0
3: 36
4: 246
1152925796_1152925804 13 Left 1152925796 17:83087243-83087265 CCCTGCGGCATCTGCTTAAACCG 0: 1
1: 0
2: 1
3: 2
4: 36
Right 1152925804 17:83087279-83087301 TTCCAGTGCCCTGTGGGTGGTGG 0: 1
1: 0
2: 1
3: 33
4: 330
1152925796_1152925801 6 Left 1152925796 17:83087243-83087265 CCCTGCGGCATCTGCTTAAACCG 0: 1
1: 0
2: 1
3: 2
4: 36
Right 1152925801 17:83087272-83087294 AGGTGATTTCCAGTGCCCTGTGG 0: 1
1: 0
2: 0
3: 20
4: 195
1152925796_1152925803 10 Left 1152925796 17:83087243-83087265 CCCTGCGGCATCTGCTTAAACCG 0: 1
1: 0
2: 1
3: 2
4: 36
Right 1152925803 17:83087276-83087298 GATTTCCAGTGCCCTGTGGGTGG 0: 1
1: 0
2: 1
3: 8
4: 211

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152925796 Original CRISPR CGGTTTAAGCAGATGCCGCA GGG (reversed) Intronic
923731621 1:236556646-236556668 CGGTTTAATCATTTGCCCCATGG + Intronic
1070772127 10:79088609-79088631 GGCTTTAAGCAGAGGCTGCAAGG + Intronic
1099134725 12:78881891-78881913 TGATTTAAGCAGATGCCTGAGGG - Intronic
1104910365 12:132237363-132237385 CGGTATAAGCAGATGTCAGAAGG - Intronic
1117462851 14:55963547-55963569 CACTTTAAGCAGATGCTGCATGG - Intergenic
1120749789 14:88186795-88186817 TGGTTTAAGAAGATGCTCCAGGG + Intronic
1121627036 14:95393275-95393297 CTGATTAAGCACATGCCACAGGG + Intergenic
1121784897 14:96649945-96649967 AGTTTTAAGCAGTTGCAGCAGGG - Intergenic
1125524855 15:40368384-40368406 CTGTTCGAGCAGCTGCCGCAGGG + Exonic
1127613798 15:60663079-60663101 AGGCTTCAGCAGATGCCACAGGG - Intronic
1134348942 16:13418425-13418447 CGGTTTCAGCAGATGCCACATGG - Intergenic
1138812604 16:60168381-60168403 CAGTTTAGGCAGATGCTGCAAGG - Intergenic
1141891049 16:86926688-86926710 TGGCTTTAGCAGATGCCACAGGG + Intergenic
1146470966 17:33124611-33124633 GGGTTTGAGCAGGTGCCACAGGG + Intronic
1152760185 17:82103580-82103602 GGGTTTGAGGAGATGCCTCAGGG - Intronic
1152925796 17:83087243-83087265 CGGTTTAAGCAGATGCCGCAGGG - Intronic
1165972567 19:39644560-39644582 TGGTTTGAGCAGATGCAACAAGG - Intergenic
1166073431 19:40399559-40399581 TGGTTTAAGCAGATGAGGCCTGG - Intronic
933374760 2:81465334-81465356 TCGTTTAAGCAGAGGCAGCATGG - Intergenic
933600337 2:84322622-84322644 CATTTCAAGCAGATGCCTCAGGG + Intergenic
1171852997 20:30321776-30321798 GGGTAGCAGCAGATGCCGCAGGG + Intergenic
1172306163 20:33882309-33882331 CTGTTTGAGCAGAAGCCGGAGGG - Intergenic
1184315513 22:43685167-43685189 TGGTTTAAGGAGATGCCTCTGGG + Intronic
953996092 3:47521180-47521202 CGGTCTCAGCAGAGGCAGCAGGG + Intergenic
955060543 3:55488653-55488675 CTCTTTCAGCAGATGCCGCGGGG - Intronic
961905836 3:130262149-130262171 AGGTTTAACCAGATGCAGAAGGG - Intergenic
965711474 3:171560059-171560081 CAGTTCAACCAGATGCAGCAAGG + Intergenic
969177449 4:5409595-5409617 CAGTTTGAGCTGATGCTGCATGG - Intronic
984707346 4:182857305-182857327 CGTTTTATGCAGATCCCGGAGGG - Intergenic
1019661886 7:2229100-2229122 CAGTTTAACCAAATGCAGCAGGG + Intronic
1042964666 8:74337644-74337666 AGCTTTCAGCAGATGCAGCAAGG + Intronic
1049223937 8:141440803-141440825 GGGTAGAAGCAGATGCCGCTGGG - Intergenic
1053790798 9:41685075-41685097 GGGTAGCAGCAGATGCCGCAGGG + Intergenic
1054179145 9:61896769-61896791 GGGTAGCAGCAGATGCCGCAGGG + Intergenic
1054474141 9:65560817-65560839 GGGTAGCAGCAGATGCCGCAGGG - Intergenic
1054658393 9:67684052-67684074 GGGTAGCAGCAGATGCCGCAGGG - Intergenic
1187527421 X:20066714-20066736 GGGTTTAAACAGATGGAGCAGGG - Intronic
1190248176 X:48704525-48704547 CTGTTTGAGCTGATGCCACAAGG + Intronic
1190581425 X:51895204-51895226 AGGTTTCAGCAGCTGCCGCTAGG + Exonic
1200091131 X:153636581-153636603 GGGTCCAAGCAGAAGCCGCAGGG - Intergenic