ID: 1152925829

View in Genome Browser
Species Human (GRCh38)
Location 17:83087378-83087400
Sequence GGCGTGGGTCCCAGCTCCGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 199
Summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 185}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152925829_1152925838 -4 Left 1152925829 17:83087378-83087400 CCCCCGGAGCTGGGACCCACGCC 0: 1
1: 0
2: 1
3: 12
4: 185
Right 1152925838 17:83087397-83087419 CGCCTGGCATCTCACGGGAACGG 0: 1
1: 0
2: 0
3: 4
4: 67
1152925829_1152925843 21 Left 1152925829 17:83087378-83087400 CCCCCGGAGCTGGGACCCACGCC 0: 1
1: 0
2: 1
3: 12
4: 185
Right 1152925843 17:83087422-83087444 ACAGATGCAGGCCCCTCCCTGGG 0: 1
1: 0
2: 4
3: 33
4: 246
1152925829_1152925834 -10 Left 1152925829 17:83087378-83087400 CCCCCGGAGCTGGGACCCACGCC 0: 1
1: 0
2: 1
3: 12
4: 185
Right 1152925834 17:83087391-83087413 GACCCACGCCTGGCATCTCACGG 0: 1
1: 0
2: 0
3: 7
4: 121
1152925829_1152925842 20 Left 1152925829 17:83087378-83087400 CCCCCGGAGCTGGGACCCACGCC 0: 1
1: 0
2: 1
3: 12
4: 185
Right 1152925842 17:83087421-83087443 CACAGATGCAGGCCCCTCCCTGG 0: 1
1: 0
2: 5
3: 28
4: 299
1152925829_1152925841 9 Left 1152925829 17:83087378-83087400 CCCCCGGAGCTGGGACCCACGCC 0: 1
1: 0
2: 1
3: 12
4: 185
Right 1152925841 17:83087410-83087432 ACGGGAACGGGCACAGATGCAGG 0: 1
1: 0
2: 1
3: 3
4: 91
1152925829_1152925835 -9 Left 1152925829 17:83087378-83087400 CCCCCGGAGCTGGGACCCACGCC 0: 1
1: 0
2: 1
3: 12
4: 185
Right 1152925835 17:83087392-83087414 ACCCACGCCTGGCATCTCACGGG 0: 1
1: 0
2: 1
3: 13
4: 118
1152925829_1152925839 -3 Left 1152925829 17:83087378-83087400 CCCCCGGAGCTGGGACCCACGCC 0: 1
1: 0
2: 1
3: 12
4: 185
Right 1152925839 17:83087398-83087420 GCCTGGCATCTCACGGGAACGGG 0: 1
1: 0
2: 0
3: 9
4: 98

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152925829 Original CRISPR GGCGTGGGTCCCAGCTCCGG GGG (reversed) Intronic